16924

Экспрессия генов

Книга

Биология и генетика

Экспрессия генов. – М.: Наука 2000. – 000 с. ил. ISBN 5020018902 В монографии рассмотрены современные представления о строении и механизмах функционирования генов прокариот и эукариот а также основные методы их исследования. Книга состоит из двух частей. В первой части обс

Русский

2013-06-28

3.88 MB

67 чел.

Экспрессия генов. – М.: Наука, 2000. – 000 с., ил.

ISBN    5-02-001890-2

В монографии рассмотрены современные представления о строении и механизмах функционирования генов прокариот и эукариот, а также основные методы их исследования. Книга состоит из двух частей. В первой части обсуждаются структура генома прокариотических и эукариотических организмов, а также механизмы транскрипции, трансляции, репликации, репарации и их регуляции. Во второй части монографии рассмотрены принципы основных методов, используемых в исследованиях генов. Главное внимание уделено современным методам генной инженерии. Обсуждаются наиболее важные аспекты развития современной молекулярной генетики в исследованиях направленного мутагенеза и белковой инженерии, антисмысловых РНК, рибозимов и дезоксирибозимов, трансгеноза и генотерапии, а также достижения в ДНК-диагностике и ДНК-типировании и изучении генома человека.

Для научных работников, аспирантов и студентов, специализирующихся в области химии и биологии.

ТП-97-П-№ 123

Patrushev L.I.

Gene Expression. – Moscow: Nauka, 2000. – 000 p., il.

ISBN 5-02-001890-2

This monograph consisting of two parts presents a comprehensive view of the structure and functioning mechanisms of genes for prokaryotes and eukaryotes as well as the basic methods used for their studies. Its first part discusses the genome structure of prokaryotic and eukaryotic organisms, also covering the mechanisms of transcription, translation, replication, DNA repair and their regulation. The second part of the monograph deals with the principles of the techniques employed in the gene research. The book devotes particular attention to current genetic engineering tools. It embraces the key aspects of recent developments of molecular genetics studies on site-directed mutagenesis, protein engineering, antisense RNA, ribozymes and deoxyribozymes, transgenosis and gene therapy, DNA diagnostics and genotyping human genome.

The book will act as authoritative references for researchers, postgraduates, and students specializing in chemistry and biology.

ISBN 5-02-001890-2

© Издательство "Наука", 2000


ОГЛАВЛЕНИЕ

[1] Предисловие редактора

[2] Предисловие автора

[3] ЧАСТЬ I. МЕХАНИЗМЫ ХРАНЕНИЯ И РЕАЛИЗАЦИИ ГЕНЕТИЧЕСКОЙ ИНФОРМАЦИИ

[4] ВВЕДЕНИЕ

[5] ГЕНОМ

[5.1] Гены и хромосомы

[5.2] Геном прокариот

[5.2.1] Геном вирусов

[5.2.2] Нуклеоид бактериальной клетки

[5.2.3] Геном архебактерий

[5.2.4] Минимальный размер генома одноклеточных организмов

[5.3] Геном эукариот

[5.3.1] Последовательности нуклеотидов эукариотического генома

[5.3.2] Хроматин

[5.3.3] Роль ДНК-топоизомераз в обеспечении структуры и функционирования хроматина

[6] РЕАЛИЗАЦИЯ ГЕНЕТИЧЕСКОЙ ИНФОРМАЦИИ ПРИ ЭКСПРЕССИИ ГЕНОВ

[6.1] Транскрипция

[6.1.1] ДНК-зависимые РНК-полимеразы

[6.1.2] Единицы транскрипции (транскриптоны)

[6.1.3] Этапы транскрипции

[6.1.4] Хроматин во время транскрипции

[6.2] Котранскрипционные и посттранскрипционные модификации РНК

[6.2.1] Процессинг РНК у бактерий

[6.2.2] Редактирование пре-мРНК

[6.2.3] Другие модификации эукариотических мРНК

[6.2.4] Кэп-связывающий комплекс в роли фактора, сопрягающего основные реакции метаболизма транскриптов РНК-полимеразы II

[6.3] Функциональная компартментализация ядра

[6.3.1] Интерфазные хромосомы в ядре

[6.3.2] Ядрышко

[6.3.3] Пространственная организация синтеза мРНК

[6.3.4] Ядерные тельца и домены

[6.3.5] Компартментализованное ядро

[6.4] Биосинтез белка рибосомами бактерий

[6.4.1] Рибосомы

[6.4.2] Этапы биосинтеза белка

[6.4.3] Антибиотики, действующие на уровне трансляции

[6.5] Трансляция у эукариот

[6.5.1] Особенности первичной структуры эукариотических мРНК

[6.5.2] Инициация биосинтеза белка эукариотическими рибосомами

[6.5.3] Элонгация полипептидных цепей

[6.5.4] Терминация трансляции

[6.5.5] Трансляция в митохондриях

[6.5.6] Трансляция в хлоропластах.

[7] ОСНОВНЫЕ ПУТИ РЕГУЛЯЦИИ ЭКСПРЕССИИ ГЕНОВ

[7.1] Регуляция экспрессии генов на уровне транскрипции у прокариот

[7.1.1] Регуляция на уровне инициации транскрипции

[7.1.2] Регуляция синтеза РНК на уровне элонгации и терминации

[7.2] Регуляция экспрессии генов на уровне транскрипции у эукариот

[7.2.1] Передача сигнала и вторичные мессенджеры

[7.2.2] Механизмы позитивной регуляции транскрипции

[7.2.3] Механизмы негативной регуляции транскрипции

[7.2.4] Структура хроматина как специфический регулятор экспрессии генов

[7.2.5] Импринтинг

[7.2.6] Метилирование ДНК в регуляции транскрипции

[7.3] Посттранскрипционная регуляция экспрессии генов

[7.3.1] Направленный транспорт, внутриклеточная локализация и депонирование мРНК

[7.3.2] Сплайсинг РНК в регуляции экспрессии генов

[7.3.3] Избирательная деградация мРНК

[7.4] Регуляция экспрессии генов на уровне трансляции

[7.4.1] Регуляция инициации трансляции

[7.4.2] Регуляция элонгации синтеза полипептидных цепей

[7.4.3] Регуляция терминации трансляции

[7.5] Синтез белков, содержащих остатки селеноцистеина

[7.6] Посттрансляционная регуляция экспрессии генов

[7.6.1] Последствия фолдинга вновь синтезированных полипептидных цепей

[7.6.2] Специфические протеиназы в посттрансляционном процессинге белков

[7.6.3] Убиквитин-зависимая система протеолиза в регулируемой деградации белков

[7.6.4] Сплайсинг белков

[7.6.5] Другие посттрансляционные модификации белков

[8] ВОСПРОИЗВЕДЕНИЕ ГЕНЕТИЧЕСКОЙ ИНФОРМАЦИИ

[8.1] Репликация ДНК

[8.1.1] Белки, участвующие в репликации ДНК

[8.1.2] Репликативная вилка E. coli и бактериофага T4

[8.1.3] Особенности функционирования репликативной вилки эукариот

[8.2] Регуляция репликации ДНК

[8.2.1] Инициация репликации ДНК у E. coli и ее регуляция

[8.2.2] Регуляция репликации плазмиды ColE1

[8.3] Особенности репликации линейных геномов

[8.3.1] Линейные хромосомы бактерий

[8.3.2] Репликаторы эукариот

[8.3.3] Репликация теломерных участков эукариотических хромосом

[8.3.4] Пространственная организация синтеза ДНК у эукариот

[9] ЗАЩИТА ГЕНЕТИЧЕСКОЙ ИНФОРМАЦИИ

[9.1] Мутации

[9.1.1] Основные источники мутаций и методы определения мутагенной активности

[9.1.2] SOS-мутагенез у бактерий

[9.1.3] Мутаторный фенотип

[9.1.4] Экспансия ДНК

[9.1.5] Адаптивные мутации

[9.1.6] Механизмы защиты генома от мутаций

[9.2] Репарация ДНК

[9.2.1] Основные механизмы репарации поврежденной ДНК

[9.2.2] Эксцизионная репарация в клетках животных

[9.2.3] Гомологичная рекомбинация в репарации ДНК

[9.2.4] Репарация ошибочно спаренных нуклеотидов

[9.2.5] Полимераза поли(ADP-рибозы) в репарации ДНК у эукариот

[9.3] Альтруистичная ДНК

[9.3.1] Парадокс возможности существования многоклеточных организмов

[9.3.2] Повышение информационной стабильности генома избыточными последовательностями

[9.3.3] Селективная защита генов от мутаций

[9.3.4] Высокоупорядоченное расположение летальных генов на хромосомах

[9.3.5] Возможный смысл парадокса С

[10] СОВРЕМЕННАЯ КОНЦЕПЦИЯ ГЕНА

[11] ЧАСТЬ II. ИСКУССТВЕННЫЕ ГЕНЕТИЧЕСКИЕ СИСТЕМЫ

[12] ПРИНЦИПЫ ГЕННОЙ ИНЖЕНЕРИИ

[12.1] Основные ферменты, используемые в генной инженерии

[12.1.1] Рестриктазы и ДНК-метилазы

[12.1.2] ДНК- и РНК-лигазы

[12.1.3] Ферменты матричного синтеза ДНК и РНК

[12.1.4] Другие ферменты

[12.2] Векторы

[12.2.1] Плазмидные векторы

[12.2.2] Векторы на основе фага 

[12.2.3] Космиды и фазмиды

[12.2.4] Сверхъемкие векторы YAC, BAC и PAC

[12.2.5] Интегрирующие и челночные (бинарные) векторы

[12.2.6] Конструирование экспрессирующих векторов и их функционирование

[12.2.7] Векторы для переноса ДНК в клетки животных и растений

[12.3] Клонотеки генов

[12.3.1] Получение клонотек генов

[12.3.2] Введение рекомбинантных ДНК в клетки

[12.3.3] Методы скрининга клонотек генов

[12.4] Эукариотические системы экспрессии рекомбинантных генов, основанные на культурах клеток

[12.4.1] Клетки яичников китайских хомячков (линия CHO)

[12.4.2] Клетки мышиной миеломы (линия Sp2/0)

[12.4.3] Клетки селезенки мышей (линия MEL)

[12.4.4] Клетки африканской зеленой мартышки (линия COS)

[12.4.5] Клетки насекомых, зараженные бакуловирусами

[12.4.6] Сравнение эффективности рассмотренных систем экспрессии

[12.5] Бесклеточные белоксинтезирующие системы

[12.5.1] Прокариотические системы

[12.5.2] Эукариотические системы

[12.5.3] Проточные системы

[12.6] Другие современные методы исследования генов

[12.6.1] Рестрикционное картирование генов

[12.6.2] "Прогулки и прыжки по хромосомам"

[12.6.3] S1-картирование РНК и ДНК

[12.6.4] Футпринтинг

[12.7] Стратегия выделения нового гена

[13] НАПРАВЛЕННЫЙ МУТАГЕНЕЗ И БЕЛКОВАЯ ИНЖЕНЕРИЯ

[13.1] Методы направленного получения мутаций

[13.1.1] Получение делеций и вставок

[13.1.2] Химический мутагенез

[13.1.3] Сайт-специфический мутагенез с использованием олигонуклеотидов

[13.1.4] Полимеразная цепная реакция в направленном мутагенезе

[13.2] Белковая инженерия

[13.2.1] Библиотеки пептидов и эпитопов

[13.2.2] Белки-репортеры в гибридных белках

[13.2.3] Гибридные токсины

[13.2.4] Подходы к созданию новых ферментов

[13.2.5]  Субтилигаза в лигировании пептидов

[13.3] Концепция ксенобиоза

[14] АНТИСМЫСЛОВЫЕ РНК, РИБОЗИМЫ И ДЕЗОКСИРИБОЗИМЫ

[14.1] Антисмысловые РНК и олигонуклеотиды

[14.1.1] Механизм действия антисмысловых РНК

[14.1.2] Использование антисмысловых РНК

[14.1.3] Природные антисмысловые РНК

[14.1.4] Антисмысловые РНК и патология: возможный механизм возникновения доминантных мутаций

[14.2] Рибозимы и дезоксирибозимы

[14.2.1] Типы рибозимов

[14.2.2] Свойства рибозимов

[14.2.3] Рибозимы как лекарственные средства

[14.2.4] Репарация мутантных РНК с помощью рибозимов, осуществляющих транс-сплайсинг

[14.2.5] Дезоксирибозимы

[14.3] Аптамеры

[14.4] Молекулы РНК у истоков жизни

[14.4.1] Молекулы РНК в качестве РНК-репликаз

[14.4.2] Возможность синтеза полипептидных цепей молекулами РНК

[15] ТРАНСГЕННЫЕ ЖИВОТНЫЕ И РАСТЕНИЯ

[15.1] Способы получения трансгенных многоклеточных организмов

[15.2] Экспрессия трансгенов

[15.3] Использование трансгенов у животных

[15.3.1] Исследование механизмов экспрессии генов

[15.3.2] Токсигены в исследовании дифференцировки соматических клеток в онтогенезе

[15.3.3] Изменение физиологического статуса лабораторных и сельскохозяйственных животных

[15.3.4] Моделирование наследственных и приобретенных заболеваний человека

[15.4] Трансгенные растения

[15.5] Генотерапия наследственных и приобретенных заболеваний

[15.5.1] Способы доставки новых генов в геном человека

[15.5.2] Управление экспрессией трансгенов в клетках-мишенях

[15.5.3] Современные достижения генотерапии онкологических заболеваний

[15.5.4] Ближайшие перспективы использования генотерапии

[15.5.5] Успехи генотерапии в модельных экспериментах

[15.5.6] Проблемы, возникающие в связи с практическим применением генотерапии

[16] ДНК-ДИАГНОСТИКА И ДНК-ТИПИРОВАНИЕ

[16.1] ДНК-диагностика наследственных и приобретенных заболеваний

[16.1.1] Получение клинического генетического материала

[16.1.2] Диагностика заболеваний

[16.2] ДНК-типирование

[16.2.1] ДНК-типирование микроорганизмов

[16.2.2] Идентификация личности на основе минисателлитной ДНК: определение отцовства

[16.3] Микроматрицы и микрочипы ДНК

[16.3.1] Методы создания микроматриц ДНК

[16.3.2] Ограничения в использовании микроматриц ДНК

[16.3.3] Использование микроматриц ДНК в фундаментальных и прикладных исследованиях

[17] КАРТИРОВАНИЕ И ОПРЕДЕЛЕНИЕ ПЕРВИЧНОЙ СТРУКТУРЫ ГЕНОМА ЧЕЛОВЕКА

[17.1] Основные подходы к картированию генома человека

[17.1.1] Генетические карты сцепления

[17.1.2] ПЦР в исследованиях генома человека

[17.1.3] Физические карты низкого разрешения

[17.1.4] Физические карты высокого разрешения

[17.2] Определение полной первичной структуры ДНК генома человека

[17.3] Базы данных получаемой информации

[17.4] ЗАКЛЮЧЕНИЕ

[17.5] РЕКОМЕНДУЕМАЯ ЛИТЕРАТУРА

[17.5.0.1] Часть II


Предисловие редактора

Сей факт с сияющим лицом

Вношу как ценный вклад в науку.

Саша Черный

Науку двигают методы и увенчивают теории. Концептуальные прорывы 1950–1960-х годов – прежде всего, двойная спираль, генетический код и механизм биосинтеза белка – легли в основу молекулярной биологии и молекулярной генетики. Этот начальный период бури и натиска завершился химико-ферментативным синтезом структурного гена аланиновой тРНК дрожжей – событием, которое далеко не все тогда оценили по достоинству. Для скудных методических возможностей того времени это был феноменальный coup de force, потребовавший пятилетних усилий группы высококвалифицированных химиков и биохимиков под руководством Гобинда Кораны, чтобы быть выполненным, и целого номера "Journal of Molecular Biology", чтобы быть описанным. Шокированный последним обстоятельством, журнал "Nature New Biology" устами своего рецензента заявил: «Подобно проекту “Аполлон”, все это сделано лишь для того чтобы показать, что это можно сделать, и, как и этот проект, никогда не будет повторено». Редко случается, чтобы пророчество оказалось настолько бездарным: последующие годы принесли сотни искусственных синтезов такого рода, причем во многих из них использовались основополагающие разработки Кораны. Протагонистом противоположной точки зрения явился Артур Корнберг, который сказал, обращаясь к Коране: “То, что Вы сделали, – это атомная бомба 1980 года”.

Первый синтез гена явился предшественником растянутого во времени большого методического взрыва 1970–1980-х годов в молекулярной биологии. К самым ярким вехам этого взрыва, наряду с олигонуклеотидным синтезом (с переходом его от искусства к ремеслу), можно отнести эндонуклеазы рестрикции, молекулярное клонирование, секвенирование нуклеиновых кислот и полимеразную цепную реакцию. В сочетании с многими другими находками, перечислить которые невозможно, это сделало молекулярную биологию методически почти всемогущей. Будущее покажет, достаточно ли этого, чтобы сбросить покровы с тайны живого.

Бурный поток оригинальных публикаций делает особенно важным жанр обзора в различных его видах. Книга – сложнейший из них, хотя современные возможности работы с литературой далеко отодвинули пределы осуществимого в этой области. Л.И. Патрушев поставил перед собой трудную задачу в одиночку охватить значительную часть современного массива достижений и перспектив молекулярной и клеточной биологии, непосредственно связанную с нуклеиновыми кислотами. На этом пути он сумел сделать удивительно много. Достаточно просмотреть оглавление, чтобы убедиться, что в книге не оставлены без внимания почти все основные направления, имеющие прямое отношение к нуклеиновым кислотам. При этом использован новейший материал, включая множество данных, опубликованных в этом году. Работа не прекращалась ни на минуту, и даже последние числа минувшего октября были свидетелями рождения новых разделов. В результате создано большое молекулярно-биологическое полотно, в котором каждый – от студента до (как это ни кощунственно) академика – может найти для себя что-то неожиданное.

По способу изложения материала квалифицировать книгу непросто. Ее не назовешь учебником в строгом смысле слова, хотя систематичность и внутренняя логика несомненны. Нередко от читателя требуется солидная подготовка, способность истолковывать аллюзии и проскакивать над эллипсисами. Зато удовлетворение от проникновения в материал очень велико.

Эта книга – не просто крупномасштабная компиляция. На ней отчетливо видна печать личности автора. Чувствуется, как небезразлично ему все то, что вот уже несколько десятилетий происходит на огромном пространстве молекулярной биологии. Многое ему удалось превосходно, хотя подстерегающие на этом пути тернии пристрастия, в частности несбалансированной нежности к порождениям собственного разума, не всегда увиты лаврами. В то же время, именно таков путь к звездам единой точки зрения, может быть, даже всеохватывающей концепции – в определенном смысле аналога единой теории поля, мысли о которой когда-то превратили в интеллектуальную трагедию закат великого физика.

Предлагаемая книга – плод эрудиции, вдохновения и самоотверженного труда Л.И. Патрушева и тех, чьи мысли и дела он цитирует, обсуждает, превозносит или критикует, – несомненно найдет множество благодарных читателей.

Ю. Берлин

Ноябрь 1999 г.


Моим родителям

Афанасии Алексеевне Агаповой и Ивану Николаевичу Патрушеву, чей свет во мне навсегда


Предисловие автора

Мы можем понять что-то в природе, только если мы размышляем о ней…

Вернер Гейзенберг

Предметные исследования, осознанно устремляясь к границам и истокам нашего бытия, становятся философскими.

Карл Ясперс

Направления молекулярной генетики, основанные на генной инженерии, начало которым было положено в 1970-х годах работами В. Арбера, П. Берга, Г. Бойера, С. Коэна и других зарубежных ученых, получили в последующие 25 лет стремительное развитие, открывшее новые горизонты биологической науки. Сегодня трудно представить себе какой-либо раздел молекулярной биологии или генетики, в котором не применялись бы достижения этих исследований. Области использования методов молекулярной генетики непрерывно расширяются, все больше охватывая, к примеру, фундаментальную и клиническую медицину, судебно-следственную практику и даже палеонтологию. Однако все эти достижения – лишь внешняя, хорошо видимая часть айсберга. Замена поврежденных генов на здоровые в генотерапии и "клонирование" многоклеточных организмов придают нашей жизни совершенно новое, грозное качество, так как ставят перед человечеством неведомые ранее этические проблемы. Для меня несомненно, что именно с 70-х годов XX в. начался новый этап эволюции биосферы Земли, все последствия которого мы еще не в состоянии предвидеть.

Работая, как и большинство из нас, в узкой области молекулярной генетики, я часто затрачивал значительные усилия на поиск сведений о каком-либо новом методе или молекулярном механизме, описание которых можно найти иногда лишь в труднодоступной англоязычной литературе. Постоянное общение с коллегами показывает, что блуждания по научной литературе в поисках ответа на теоретические вопросы, возникающие в процессе экспериментальной работы, не являются исключительно моими трудностями. Поэтому стремление сохранить время и облегчить жизнь коллегам-экспериментаторам было одной из движущих сил, заставивших написать эту книгу.

Однако не только указанная причина побудила меня взяться за перо. Оборотной стороной лавинообразного накопления научной информации является размывание контуров целостной картины современных молекулярно-генетических знаний. В соответствии с формулировкой Г. Вейля (берущей начало от Г. Галилея), метод естественных наук включает в себя пассивное наблюдение, уточняемое с помощью активного эксперимента, и построение символической конструкции, к которой в конечном счете сводятся естественно-научные теории. Высшей формой символической конструкции является математическая формула. На пути к своей цели – символической конструкции, непротиворечиво объединяющей эмпирические факты, – естественно-научные теории неизбежно проходят предварительные стадии, в том числе и стадию классификации или морфологии.

То, что в основном происходит сегодня в нашей молодой области биологии, напоминает скрупулезные усилия ботаников или зоологов-систематиков, стремящихся как можно полнее описать фауну и флору нашей планеты. Открываются все новые и новые гены, ферменты, биохимические механизмы и метаболические пути, которые переплетаются в сложнейшие сети. Миллиарды пар оснований отсеквенированных последовательностей ДНК призваны внести ясность в наше понимание структуры и функционирования генома. И хотя это совершенно закономерный и необходимый этап развития науки, одних только эмпирических фактов явно недостаточно для наступления ясности.

Складывающуюся ситуацию, в частности хорошо иллюстрирует положение в современной онкологии. Громадные усилия и средства, затрачиваемые в мире на изучение молекулярных механизмов канцерогенеза, приносят обильные плоды в виде новых генов и белков-регуляторов клеточного цикла, передачи сигнала и механизмов регуляции апоптоза. Однако прямолинейные попытки управления экспрессией этих конкретных генов с помощью антисмысловых РНК, рибозимов, анти-генов и других современных молекулярно-генетических подходов пока не привели к удовлетворительным результатам в генотерапии онкологических (и каких-либо других системных) заболеваний. Заболеваемость раком, в том числе и в промышленно развитых странах, непрерывно возрастает и по прогнозам Всемирной организации здравоохранения к 2020 году удвоится. Пока не слишком успешными остаются и попытки борьбы со СПИДом. Такого рода факты ясно показывают, насколько далеки мы сегодня от понимания живого организма как целого.

Кроме эмпирических фактов требуются новые обобщающие идеи и в конечном счете фундаментальные символические конструкции, которые бы продвинули генетику на пути понимания законов генетического контроля жизнедеятельности клетки и организма в целом. В этой связи не менее важной целью написания книги была попытка систематизировать современные достижения в исследовании механизмов регуляции экспрессии генов на всех основных уровнях реализации генетической информации и обсудить ряд новых концепций, рожденных в ходе исследований. Я надеялся, что некоторые не слишком широко известные факты в свою очередь помогут генерировать новые знания. Однако книга не является полностью компилятивной. Наряду с современной классикой в ней представлены и результаты оригинальных исследований, которые включают, в частности концепции ксенобиоза и альтруистичной ДНК, а также гипотезы о функциональном значении редактирования РНК на посттранскрипционном уровне и образовании доминантных мутаций с участием антисмысловых РНК.

Книга состоит из двух частей. В первой части рассматриваются молекулярные механизмы, обеспечивающие хранение генетической информации живых организмов и ее реализацию через экспрессию генов. При этом основное внимание уделяется генетическим системам эукариот. Поскольку любой ген существует благодаря передаче его точной копии соматическим клеткам и в ряду поколений организмов, в конце первой части обсуждаются механизмы репликации ДНК, репарации ее повреждений, а также другие способы стабилизации генетической информации.

Вторая часть книги посвящена обсуждению современных достижений молекулярной генетики в ее прикладных областях. Однако использование термина "прикладные" в этом контексте не совсем корректно. Результаты, полученные в исследованиях трансгеноза, рибозимов или при решении задач белковой инженерии изменили облик всей современной генетики и потребовали пересмотра многих теоретических представлений.

К сожалению, ограничения в объеме книги не позволили реализовать в ней первоначально задуманную главу "Гены и фенотип", а также обсудить современные достижения в исследовании рекомбинации ДНК. По тем же причинам упомянуты не все авторы, работы которых обсуждаются в монографии. Им я приношу свои глубокие извинения. Исчерпывающую библиографию можно найти в современных обзорах из списка рекомендованной литературы, которая предназначена для более глубокого знакомства с предметом.

На протяжении всей книги мне хотелось подчеркнуть единство генетических систем организма. Отдельное рассмотрение систем транскрипции, трансляции, репарации или репликации условно, поскольку их функционирование в клетке тесно взаимосвязано. На это указывает, в частности высокая интеграция многочисленных механизмов внутриклеточной передачи сигнала, полифункциональность отдельных белков и ферментов, колоссальное разнообразие летальных мутаций и плейотропность действия генов.

Работая над книгой, я всегда имел в виду, что ясное представление о целом может быть хорошим помощником в исследовании частных генетических проблем. Но и сама генетика является лишь малой частью творения духа человека. В лаборатории, клинике, на пленэре или в мастерской мы пишем этюды к большой картине, которой, к счастью, никогда не суждено быть завершенной. И в те редкие минуты, когда работа идет особенно хорошо, отчетливо ощущаешь причастность к этому великому движению духовных сфер, во многом определяющему смысл нашей жизни.

В заключение предисловия хочется выразить особую признательность дирекции и Ученому совету Института биоорганической химии им. М.М. Шемякина и Ю.А. Овчинникова РАН за оказанную поддержку в издании книги.

Работа над книгой проходила параллельно с экспериментальными исследованиями в стенах лаборатории биотехнологии ИБХ, руководимой А.И. Мирошниковым, в лице которого я нашел полное понимание. За это я хочу принести ему свою искреннюю благодарность.

Мое мировоззрение как генетика начало складываться и во многом определилось в аспирантуре на семинарах Р.Б. Хесина, а также при личном общении с этим замечательным человеком и сотрудниками его лаборатории. Ко всем этим людям, ученым и учителям, с которыми мне посчастливилось работать в начале жизненного пути, я храню чувство глубокой благодарности.

Я отдаю себе отчет в том, что монография никогда не была бы написана без высокого профессионализма, постоянного интереса и дружеского участия заведующей научно-информационным отделом Института Т.И. Соркиной, от которой исходит сама идея этого издания. В долгих и плодотворных дискуссиях с ней обсуждалась общая структура книги и содержание отдельных глав, а также многочисленные технические детали, о которых перед началом работы я, к сожалению, не имел ни малейшего представления. Одновременно я приношу свою глубокую благодарность сотрудникам отдела В.В. Егоровой, Т.И. Яковлевой, И.М. Приваловой и Л.И. Петровой за большую техническую помощь при подготовке рукописи к печати.

Хотелось бы выразить искреннюю признательность Е.Д. Свердлову за жесткую и конструктивную критику первых двух глав монографии, которая оказала сильное влияние на всю дальнейшую работу над книгой. Сейчас невозможно представить себе выход монографии в свет без учета многочисленных глубоких замечаний Ю.А. Берлина, у которого я многому научился в ходе нашего продолжительного общения.

Пользуясь случаем, хотелось бы выразить особую признательность всем зарубежным коллегам, приславшим оттиски своих недавних публикаций.

И в заключение, но не в последнюю очередь, я хотел бы от всей души поблагодарить свою жену Раю, такт, мудрость и душевная аура которой, несмотря на все мои недостатки, помогают поддерживать творческую атмосферу в семье. Без всего этого написание книги было бы невозможно.

Неоценимая помощь профессионалов не снимает с меня ответственности за фактическую сторону материала, представленного в монографии. Я буду благодарен за любую конструктивную критику всех спорных интерпретаций генетических фактов, а также замеченных ошибок и неточностей, которые, к сожалению, чаще всего можно увидеть только на расстоянии.

Л.И. Патрушев



ЧАСТЬ I. МЕХАНИЗМЫ ХРАНЕНИЯ И РЕАЛИЗАЦИИ ГЕНЕТИЧЕСКОЙ ИНФОРМАЦИИ


ВВЕДЕНИЕ

Организм. Живой организм представляет собой самовоспроизводящуюся, открытую термодинамическую систему, в которой пути превращения вещества и энергии определяются генетической информацией, реализующейся через генетический код. В таком несколько измененном определении М. Барбьери (1998 г.) сформулирован один из фундаментальных принципов биологии конца XX в. Сама возможность появления этого глобального обобщения, по мнению Барбьери, связана с тремя крупнейшими прорывами в биологических исследованиях уходящего века. Биохимиками была определена функциональная роль белков, генетикам удалось приподнять завесу над миром генетической информации, а молекулярные биологи установили, что связь между этими двумя мирами осуществляется через генетический код.

Поскольку организм является самовоспроизводящейся системой, он должен обладать информацией, необходимой и достаточной для поддержания своего status quo и производства себе подобных. Словосочетание открытая термодинамическая система подчеркивает, что все проявления жизнедеятельности организма могут быть объяснены в терминах естественных наук, а одним из необходимых условий его существования является обмен с окружающей средой веществом, энергией и информацией в разных формах, включая генетическую информацию.

По современным представлениям вся генетическая информация живого организма содержится в его генах и, как любая другая информация, заключает в себе сообщения, в данном случае сообщения для молекулярных объектов, способных их воспринять. Сама возможность восприятия генетической информации определяется тем, что сообщения организованы с помощью системы правил (генетического кода), "понятных" объектам, для которых эти сообщения предназначены. Получив генетическое сообщение, молекулярный объект его декодирует в соответствии с правилами, лежащими в основе функционирования его составных частей. Даже частичное невыполнение этих правил может приводить к тяжелым нарушениям жизнедеятельности организма.

Во время передачи генетической информации по существующим каналам связи от генов к воспринимающим молекулярным объектам имеет место ее многократное декодирование и перекодирование вплоть до окончательного воплощения в фенотипических признаках. Происходит экспрессия генов. Можно сказать, что в результате экспрессии генов заключенное в них слово материализуется в деяние. Однако это не более чем метафора: природа без человека лишена членораздельной речи. Было бы непродуктивно, не опираясь на демиурга, искать в строении организмов предсуществующий план, а в действии генов – цель.

Клетка. Клетка является той наименьшей частью организованной материи, которая еще сохраняет все признаки живого. В ней происходят основные события, связанные с экспрессией генов. Лишь в клетке может полноценно реализовываться генетическая информация, заключенная в генах. Рассмотрение генов в отрыве от их естественного внутриклеточного окружения приводит к искусственному разделению генома на функционально оторванные друг от друга фрагменты, созданию емких баз данных последовательностей нуклеиновых кислот. Современные попытки заставить функционировать гены в новом генетическом окружении завершаются в лучшем случае получением нежизнеспособных в природных условиях биореакторов – организмов-сверхпродуцентов собственных или чужеродных белков и метаболитов.

Связь между генами и внутриклеточным генетическим окружением неразрывна. Компоненты клетки, распознавая гены, считывают заключенную в них информацию и декодируют ее. При этом они поддерживают гены в рабочем состоянии и их воспроизводят, создавая точную копию носителя информации, гарантию существования самих себя. Действительно, в ответ на это гены предоставляют инструкции, необходимые для внутриклеточного клонирования самих молекулярных компонентов клеток, а следовательно (по крайней мере, в случае одноклеточных организмов) создания их точных копий. Функционирует единая система, части которой невозможно разъединить, не уничтожив живое. Тем не менее, суть связей между компонентами генетической системы, организованной в клетку, – это не порочный круг. Напротив, рассматривая систему, как единое целое, в ней можно обнаружить внутренний потенциал направленного развития, который реализуется во времени, материализуясь в биосфере.

В этой связи популярные еще и сегодня рассуждения об эгоистическом гене, заставляющем клетку работать только на себя, лишены глубокого смысла. Последовательно оставаясь на такого рода антропоморфных позициях, необходимо признать, что и эгоистически настроенные белки могут рассматривать ДНК как сожителя, существование которого приходится терпеть для воспроизводства самих себя.

"Omnia mea mecum porto!1" – этот девиз в полной мере применим к одноклеточным организмам. У многоклеточных генетических систем это не так. В данном случае отдельные клетки, составляющие организм, становятся зависимыми друг от друга, создавая неразрывное единство на другом уровне – сомы, или тела. Между клетками происходит контролируемое генами перераспределение функций. При этом клетки разных частей многоклеточного организма могут настолько различаться морфологически, что без проведения специального анализа на молекулярном уровне их невозможно отнести к одной генетической системе, единому организму.

Пролиферация, дифференцировка и апоптоз соматических клеток. Переход к многоклеточности перевел отношения организма с окружающим миром на новый уровень сложности. Многочисленные связи между рецепторами организма и внешними воздействиями, с одной стороны, а также внутренними анализаторами поступающей информации, с другой, обеспечивают максимальную приспособленность организма к условиям существования. Жизнь не прощает ошибок. Все, что неадекватно реагирует на сигналы среды существования, элиминируется естественным отбором. Чем чувствительнее и эффективнее система настроена на окружающий мир (в том числе и внутреннюю среду организма), тем сложнее и изощреннее ее морфологическое воплощение, ее внутреннее содержание.

Пролиферация клеток. В основе развития любого многоклеточного организма, становления системы его органов и тканей лежит деление (пролиферация) клеток. Генетическая программа обеспечивает протекание сложной совокупности биохимических реакций, сопровождаемых созданием точной копии генетического аппарата каждой соматической клетки, ее ростом и делением. Поскольку при каждом делении клеток весь глобальный биохимический процесс циклически повторяется, он получил название клеточного цикла. Индивидуальное (онтогенетическое) развитие, как правило, начинается с первого деления стимулированного к этому яйца (яйцеклетки) и завершается только с наступлением его смерти – распада организма как целого в результате обрыва ключевых внутренних связей между системами его жизнеобеспечения. Основное внутреннее событие жизни организма – деление клеток – находится под строгим внутренним и внешним генетическим контролем. Даже изолированная соматическая клетка способна лишь к ограниченному количеству делений в питательной среде. Количественный контроль числа клеточных делений лежит в основе органогенеза (формирования органов и тканей). Нарушение механизмов контроля пролиферации клеток приводит к безудержному делению клеток, образованию бесформенной клеточной массы – опухоли, способной задушить организм изнутри. Однако в процессе нормального онтогенетического развития изменяется не только число соматических клеток, но и их качественный состав.

Дифференцировка клеток. Способность органов и тканей осуществлять свои специфические функции целиком зависит от наличия в них специализированных клеток. В частности, организм взрослого человека составлен из ~1014–1015 клеток более чем 100 различных типов. На самых ранних стадиях развития зародыша многоклеточного организма составляющие его клетки внешне очень похожи друг на друга. По мере продолжения онтогенеза пути многих из них далеко расходятся. Происходит дифференцировка клеток, приобретение ими специализированных функций. Морфологические различия, выявляемые у специализированных клеток, определяются особым составом и внутриклеточной организацией их молекул. Появление таких особенностей на молекулярном уровне также контролируется генами. В специализированных (дифференцированных) клетках или их предшественниках кроме генов, экспрессирующихся в клетках всех типов, работают особые группы генов. Переключение экспрессии одних групп генов на другие, подключение к экспрессии новых генов и прекращение работы старых в дифференцирующихся клетках также находится под строгим генетическим контролем.

Апоптоз. Еще одним важным событием индивидуального развития организма является полное замещение одних групп клеток другими. При этом конечные стадии процесса замены контролируются самими замещаемыми клетками. На определенной стадии развития эмбриона в ответ на сигналы окружающих тканей внутри удаляемых клеток происходит активация группы генов, запускающих их саморазрушение – апоптоз. Апоптоз является одним из проявлений принципа самоочищения организма, когда для становления и сохранения целого многоклеточный организм жертвует небольшой частью своих соматических клеток. Действительно, другой не менее важной стороной этого процесса является защита организма от клеток с необратимо поврежденным генетическим аппаратом, поскольку в этом случае возникает опасность их неконтролируемого роста и гибели целого организма. В том случае, если повреждения генетического аппарата клетки невозможно восстановить, клетка совершает самоубийство.

С учетом всего сказанного можно без преувеличения утверждать, что пролиферация, дифференцировка и апоптоз соматических клеток определяют ключевые моменты внутренней жизни многоклеточного организма.

Гены. В соответствии с центральным постулатом молекулярной биологии принято считать, что генетическая информация, необходимая для индивидуального развития организма, заключена в его генах, которые представляют собой последовательности нуклеотидов молекул ДНК и РНК. Гены содержат информацию о составных частях организма: совокупности большого числа высоко- и низкомолекулярных химических соединений, образующих его клетки, ткани и органы. При этом данные о структуре почти всех низкомолекулярных соединений, называемых метаболитами, закодированы в генах не прямо, а косвенно. Фактически эта информация является лишь программой биосинтеза метаболитов. Сама же структура и взаимодействие метаболитов друг с другом определяются биологическими катализаторами белковой природы – ферментами, которые и осуществляют необходимые их взаимопревращения – метаболизм.

Генетическая информация о структуре белков и ферментов скрыта в генах не так глубоко. Благодаря существованию универсального триплетного генетического кода, последовательности нуклеотидов генов однозначно определяют последовательности аминокислот полипептидных цепей конкретных белков. Декодирование информации о структуре белков и нуклеиновых кислот, сопровождаемое их биосинтезом, является важнейшим промежуточным (но не конечным) результатом функционирования (экспрессии) генов любого организма.

Экспрессия генов. В норме экспрессия генов обеспечивает существование организма как целого от начальных до завершающих стадий индивидуального развития – от первых делений стимулированной яйцеклетки до естественной смерти организма. Однако более широкий подход к проблеме экспрессии генов должен учитывать не только биохимические последствия их работы на молекулярном, надмолекулярном и организменном уровне, но и генетически детерминированные поведенческие реакции групп особей в популяции, а следовательно, и механизмы генетического контроля развития самих популяций, включая цивилизацию.

При реализации запрограммированных фенотипических эффектов работающие вместе гены и продукты их экспрессии правильно декодируют адресованные им (и только им) регуляторные сообщения на всех уровнях и адекватно на них отвечают. Адресная доставка и расшифровка как регуляторных сигналов, так и самой генетической информации, заключенной в генах, становятся возможными благодаря осуществлению высокоспецифических молекулярных взаимодействий.

Специфичность всех биохимических реакций обеспечивается способностью высокомолекулярных соединений организма безошибочно распознавать друг друга и низкомолекулярные метаболиты. Специфическое межмолекулярное узнавание, которое определяет упорядоченное протекание всех генетических процессов, осуществляется, по крайней мере, на трех уровнях. На первом уровне (в соответствии с последовательностью основных событий, происходящих при реализации генетической информации) имеет место специфическое распознавание друг друга нуклеиновыми кислотами. Цепи одной молекулы ДНК взаимодействуют между собой по принципу комплементарности в соответствии с правилами Уотсона–Крика, что характерно и для соответствующих контактов ДНК с РНК, а также для взаимодействия молекул РНК друг с другом. Такой тип взаимодействий лежит в основе самовоспроизведения генетической информации и ее передачи от нуклеиновых кислот к нуклеиновым кислотам или белкам. Второй уровень обеспечивается белково–нуклеиновым узнаванием. Этот крайне важный тип взаимодействий регулирует экспрессию генов и способствует упорядоченному метаболизму нуклеиновых кислот. И, наконец, взаимодействие белков друг с другом, с иными макромолекулами клеток или с низкомолекулярными лигандами делает возможной сборку молекулярных и надмолекулярных комплексов, обеспечивающих направленное протекание метаболических процессов, и лежит в основе морфогенеза организмов. Кроме всего прочего, этот тип взаимодействий может изменять специфичность действия белков и индуцировать в них новую активность.

Постепенно становится ясно, что во время реализации генетической информации в процессе биосинтеза нуклеиновых кислот, белков и ферментов формируются сложные пространственные структуры из белков и нуклеиновых кислот в результате их самоорганизации, часто при участии других молекул клетки. Самоорганизация синтезированных макромолекул приводит к образованию пространственных внутриклеточных межмолекулярных структур, клеточных органелл и, в конечном счете, самих клеток, которые в совокупности создают многоклеточный организм, законы функционирования и предназначение которого во многом остаются непонятными и сегодня.


  1.  ГЕНОМ

Термин "геном" был предложен Г. Винклером в 1920 г. для описания совокупности генов, заключенных в гаплоидном наборе хромосом организмов одного биологического вида. Первоначальный смысл этого термина указывал на то, что понятие генома в отличие от генотипа является генетической характеристикой вида в целом, а не отдельной особи. С развитием молекулярной генетики значение данного термина изменилось. Сейчас хорошо известно, что ДНК, которая является носителем генетической информации у большинства организмов и, следовательно, составляет основу генома, включает в себя не только гены в современном смысле этого слова. Большая часть ДНК эукариотических клеток представлена некодирующими ("избыточными") последовательностями нуклеотидов, которые не заключают в себе информации о белках и нуклеиновых кислотах. Таким образом, основную часть генома любого организма составляет вся ДНК его гаплоидного набора хромосом.

Однако генетическую информацию в клетках содержат не только хромосомы ядра. Жизненно важная генетическая информация бывает заключена и во внехромосомных молекулах ДНК. У бактерий к таким ДНК относятся плазмиды и некоторые умеренные вирусы, в клетках эукариот – это ДНК хлоропластов, митохондрий и других пластид. Более того, объемы генетической информации, заключенной в клетках зародышевой линии (предшественники половых клеток и сами гаметы) и соматических клетках, в ряде случаев существенно различаются. В онтогенезе соматические клетки могут утрачивать часть генетической информации клеток зародышевой линии, амплифицировать группы последовательностей и(или) значительно перестраивать исходные гены. Следовательно, под геномом организма в настоящее время понимают суммарную ДНК гаплоидного набора хромосом и каждого из внехромосомных генетических элементов, содержащуюся в отдельной клетке зародышевой линии многоклеточного организма. Однако сформулировать определение генома отдельного биологического вида в целом не так просто. В таком определении необходимо учитывать, во-первых, генетические различия, связанные с полом организма, поскольку мужские и женские половые хромосомы различаются. Во-вторых, из-за громадного числа аллельных вариантов генов и сопутствующих последовательностей, которые присутствуют в генофонде больших популяций, можно говорить лишь о некоем усредненном геноме, который сам по себе может обладать существенными отличиями от геномов отдельных особей.

Как видно из табл. I.1, размеры геномов организмов разных видов значительно отличаются друг от друга. При этом часто не наблюдается корреляции между уровнем эволюционной сложности биологического вида и размером его генома.


Таблица I.1

Средний размер гаплоидного генома у некоторых групп организмов

Группы организмов

Средний размер генома, п.о.

Мелкие вирусы

1,0·104

Микоплазмы

1,6·106

Бактерии

2,0·106

Грибы

4,7·107

Насекомые

2,3·109

Моллюски

1,6·109

Костистые рыбы

1,4·109

Амфибии бесхвостые

2,7·109

хвостатые

3,6·1010

Рептилии

1,5·109

Птицы

1,2·109

Млекопитающие

2,6·109

человек

3,0·109

Растения голосеменные

1,6·1010

покрытосеменные

2,7·1010

лилия Lilium longiflorum

1,8·1011

 

Суммарное количество ДНК в гаплоидном геноме принято обозначать латинским символом С. В 1978 г. Т. Кавалье-Смит описал в качестве парадокса наблюдение того, что у эукариот транскрибируется лишь незначительная часть последовательностей нуклеотидов генома (3% генома человека). В соответствии с этим необъясненный до недавнего времени феномен значительной избыточности генома эукариот в отношении некодирующих последовательностей нуклеотидов известен в генетике под названием "парадокса С". По моему мнению (см. раздел 5.3), эволюционное включение избыточных последовательностей нуклеотидов в исходный геном-предшественник стабилизировало заключенную в нем генетическую информацию, что, в свою очередь, создало необходимые условия для возникновения многоклеточности в природе.

Структурная организация генома является фундаментальным таксономическим признаком, лежащим в основе современной систематики животного и растительного мира. В соответствии со структурной организацией генома все живые организмы разделяют на два надцарства: прокариот и эукариот. К прокариотам относят организмы, геном которых не заключен в ядро, ограниченное ядерной мембраной, и его редупликация не сопровождается митозом. Надцарство прокариот включает в себя три царства: архебактерий (Archaebacteria), шизомикофитов (Shizomycophyta) и цианофитов (Cyanophyta). Таким образом, к прокариотам относятся сине-зеленые водоросли, актиномицеты, все бактерии, микоплазмы, риккетсии и вирусы.

Клетки эукариот содержат оформленное ядро, и редупликация их генома сопровождается митозом. В надцарство эукариот входят царства: мезокариоты (жгутиконосцы) (Mesokaryotes), грибы (Fungi), растения (Planta) и животные (Animalia). Характерная структура генома прокариот и эукариот накладывает отпечаток на морфологические, физиологические, биохимические и генетические особенности этих организмов, которые в конечном счете определяются генетической информацией, заключенной в их геномах и реализующейся через экспрессию соответствующих генов. Таким образом, можно без преувеличения сказать, что структура генома лежит в основе всех тех внутренних и внешних проявлений жизнедеятельности любого организма, которые определяют его положение в иерархии живых существ, населяющих нашу планету.

  1.  Гены и хромосомы

Генетическая информация о структуре отдельных белков и нуклеиновых кислот у всех организмов заключена в молекулах ДНК или РНК в виде последовательностей нуклеотидов, называемых генами. Однако одной информации о структуре макромолекул, кодируемых генами, недостаточно для их функционирования. Координированная работа (экспрессия) большого числа генов возможна лишь благодаря наличию тонких регуляторных механизмов, определяющих место, время и уровень экспрессии конкретного гена или группы генов. Для того чтобы экспрессия гена была регулируемой, он должен содержать индивидуальную (регуляторную) метку, по которой регуляторные компоненты генетической системы клетки или организма могли бы безошибочно оказать на него необходимое воздействие. В соответствии с этим любой ген состоит из двух основных функциональных частей (последовательностей нуклеотидов) – регуляторной и структурной. Регуляторная часть обеспечивает первые этапы реализации генетической информации, заключенной в структурной части гена, которая, в свою очередь, содержит информацию о структуре конкретных белков или нуклеиновых кислот. Поэтому размер гена складывается из размеров его структурной и регуляторной частей. Однако определить протяженность гена не так просто, особенно в случае генов эукариот.

Отдельные элементы регуляторной области генов, например энхансеры, могут располагаться на значительном (>60 т.п.о.) расстоянии от структурной части гена как перед ней, так и позади нее или даже в ней самой. В самой же структурной части большинства эукариотических генов кодирующие последовательности нуклеотидов (экзоны) перемежаются протяженными некодирующими последовательностями (интронами). Суммарный размер интронов, как правило, многократно превышает суммарный размер экзонов конкретных генов. Уже исходя из этого факта, можно сделать вывод о том, что геном любого эукариотического организма содержит не только последовательность нуклеотидов с генетической информацией о белках и нуклеиновых кислотах, но и большое количество последовательностей нуклеотидов, не несущих такой информации.

Однако помимо интронов в геноме эукариот имеется большое количество других некодирующих последовательностей нуклеотидов, главным образом различных повторяющихся последовательностей. Поэтому общая длина некодирующих последовательностей нуклеотидов в геноме эукариот в десятки раз превышает длину кодирующих последовательностей. Не вполне определенные и очень большие размеры генов эукариот, к тому же расположенных в геноме среди многочисленных некодирующих последовательностей нуклеотидов, создают значительные трудности для изучения их структуры и функционирования in vivo.

Как у прокариотических, так и у эукариотических организмов все гены располагаются группами на отдельных молекулах ДНК, которые при участии белков и других макромолекул клеток организуются в хромосомы. Зрелые клетки зародышевой линии (гаметы – яйцеклетки, спермии) многоклеточных организмов содержат по одному (гаплоидному) набору хромосом организма. У диплоидных (полиплоидных) организмов, клетки которых содержат по одному (несколько) набору хромосом каждого из родителей, одинаковые хромосомы получили название гомологичных хромосом, или гомологов. Гомологичными являются и одинаковые хромосомы разных организмов одного биологического вида. Гены и некодирующие последовательности нуклеотидов, заключенные в хромосомах ядер клеток, представляют большую часть генома организма. Кроме того, геном организма формируют и внехромосомные генетические элементы, которые во время митотического цикла воспроизводятся независимо от хромосом ядер. Так, митохондрии грибов и млекопитающих содержат менее 1% всей ДНК, тогда как у почкующихся дрожжей Sacharomyces cerevisiae митохондриальная ДНК составляет до 20% всей ДНК клетки. ДНК пластид растений (главным образом хлоропластов и митохондрий) составляет от 1 до 10% суммарного количества их ДНК.

Поскольку гены, входящие в состав отдельных хромосом, находятся в одной молекуле ДНК, они образуют отдельную группу сцепления и в отсутствие рекомбинации вместе передаются от родительских клеток к дочерним. Остаются до конца не понятыми физиологическое значение распределения генов по отдельным хромосомам и природа факторов, определяющих число хромосом в геноме эукариот. Например, невозможно объяснить эволюционные механизмы появления большого числа хромосом у конкретных организмов только ограничениями, накладываемыми на максимальный размер молекул ДНК, входящих в состав этих хромосом. Так, геном американской амфибии Amphiuma содержит в ~30 раз больше ДНК, чем геном человека, и вся ДНК заключена только в 28 хромосомах, что вполне сопоставимо с кариотипом человека (46 хромосом). Однако даже самая маленькая из этих хромосом больше самых крупных хромосом человека. Остаются неизвестными и факторы, ограничивающие верхний предел числа хромосом у эукариот. Например, у бабочки Lysandra nivescens диплоидный набор составляет 380–382 хромосомы, и нет основания считать, что это значение является максимально возможным.

По-видимому, большинство особенностей структурной и функциональной организации генома должны обеспечивать надежность его функционирования, т.е. точность передачи генетической информации от родительских клеток дочерним на протяжении многих клеточных генераций и правильную работу генов. Поэтому можно предполагать, что они имеют, прежде всего, отношение к обеспечению надежности передачи и внутриклеточной реализации генетической информации, проявляющейся в упорядоченной во времени и безошибочной экспрессии генов.

  1.  Геном прокариот

Как уже было упомянуто выше, основной чертой молекулярной организации прокариот является отсутствие в их клетках (или вирионах – вирусных частицах, в случае вирусов) ядра, отгороженного ядерной мембраной от цитоплазмы, если она существует. Отсутствие ядра является лишь внешним проявлением особой организации генома у прокариот, которая коренным образом отличается от таковой у эукариотических организмов. В отличие от эукариот, геном прокариот построен очень компактно. Количество некодирующих последовательностей нуклеотидов минимально, интроны редки. Более того, у прокариот для кодирования белков часто используются две или все три рамки считывания одной и той же последовательности нуклеотидов гена, что повышает кодирующий потенциал их генома без увеличения его размера. Многие механизмы регуляции экспрессии генов, использующиеся у эукариот, никогда не встречаются у прокариот. Это не относится к вирусам животных и растений, которые, являясь внутриклеточными паразитами эукариотических клеток, используют необходимую часть их генетического потенциала для своих нужд. Таким образом, простота строения генома прокариот объясняется, прежде всего, их упрощенным жизненным циклом, на протяжении которого прокариотические клетки, как правило, не претерпевают сложных дифференцировок, связанных с глобальным переключением экспрессии одних групп генов на другие, или тонким изменением уровней их экспрессии, что имеет место в онтогенетическом развитии эукариот.

Геном вирусов

По определению Х. Френкель-Конрата, "вирусы – это частицы, состоящие из одной или нескольких молекул ДНК или РНК, обычно (но не всегда) окруженных белковой оболочкой; вирусы способны передавать свои нуклеиновые кислоты от одной клетки-хозяина к другой и использовать ее ферментативный аппарат для осуществления своей внутриклеточной репликации путем наложения собственной информации на информацию клетки-хозяина; иногда вирусы могут обратимо включать свой геном в геном хозяина (интеграция), и тогда они либо ведут "скрытое существование", либо так или иначе трансформируют свойства клетки-хозяина"2. В приведенном определении отмечены характерные особенности жизненного цикла вирусов, которые находят отражение в организации их генома. Вирусы являются внутриклеточными паразитами и используют для своего размножения белоксинтезирующий аппарат клетки-хозяина. Жизненный цикл вируса начинается с проникновения внутрь клетки. Для этого он связывается со специфическими рецепторами на ее поверхности и либо вводит свою нуклеиновую кислоту внутрь клетки, оставляя белки вириона на ее поверхности, либо проникает целиком в результате эндоцитоза. В последнем случае после проникновения вируса внутрь клетки следует его раздевание – освобождение геномных нуклеиновых кислот от белков оболочки, что делает вирусный геном доступным для ферментных систем клетки, обеспечивающих экспрессию генов вируса.

После проникновения вируса в клетку может происходить его размножение, часто сопровождаемое гибелью самой клетки (вирулентный путь развития). Кроме того, вирус может длительное время существовать внутри клетки, внешне ничем себя не проявляя (латентная инфекция). В этом случае его геном встраивается в геном клетки-хозяина и реплицируется вместе с ним или находится во внехромосомном состоянии. После проникновения вирусной геномной нуклеиновой кислоты в клетку заключенная в ней генетическая информация должна быть расшифрована генетическими системами хозяина и использована для синтеза компонентов вирусных частиц. Поскольку для своего размножения вирусы используют главным образом ферментные системы клетки-хозяина, их геном характеризуется относительно малыми размерами и кодирует структурные белки вирионов, а также белки и ферменты, которые перестраивают метаболизм клетки для нужд размножения вируса, делая процесс репликации вирусов максимально эффективным. Геном вирусов, заключенный внутри вирионов, может быть представлен одноцепочечными или двухцепочечными ДНК или РНК. Кроме того, все гены вирусов могут быть заключены в одной хромосоме или разделены на несколько блоков (хромосом), которые все вместе и составляют геном таких вирусов. Например, у реовирусов геном представлен двухцепочечной РНК и состоит из десяти сегментов. Геномы вирусов, содержащих одноцепочечную РНК, также могут быть либо цельными (например у ретровирусов), либо сегментированными (например у ортомиксовирусов или аренавирусов). Геном РНК-содержащих вирусов представлен только линейными молекулами РНК.

Все известные ДНК-содержащие вирусы позвоночных имеют геном, заключенный в одной хромосоме, линейной или кольцевой, одно- или двухцепочечной. У некоторых вирусов, например у вируса гепатита В, геном представлен кольцевой ковалентно замкнутой молекулой двухцепочечной ДНК, в обеих цепях которой в разных местах обнаружены одноцепочечные участки. У нескольких родов, например адено-ассоциированных вирусов комплементарные цепи ДНК находятся в различных вирусных частицах.

Нуклеоид бактериальной клетки

Каждый, кому приходилось разрушать бактериальные клетки в мягких условиях, например с помощью лизоцима или детергентов, наблюдал замечательную картину превращения легко подвижной суспензии бактериальных клеток в вязкую желеобразную массу, простое перемешивание которой требует усилий. Это происходит из-за того, что компактно упакованные гигантские хромосомы бактериальных клеток (длина хромосомной ДНК E. coli составляет 4,6 млн. п.о.) после разрушения оболочки клеток выходят в окружающую среду и свободно в ней распределяются. В лизатах бактериальных клеток их ДНК прочно ассоциированы с белками, освобождение от которых требует проведения многократных фенольных депротеинизаций. Такой простой опыт наглядно указывает на то, что в бактериальных клетках их единственная хромосома сильно компактизована и, возможно, пространственно упорядочена.

Электронно-микроскопическое изучение срезов бактериальных клеток в разных условиях и более ранние исследования бактерий с помощью светового микроскопа продемонстрировали компактное распределение ДНК в бактериальной клетке. Поскольку такие структуры отдаленно напоминали ядра эукариот, они получили название нуклеоидов, или ДНК-плазмы. Эти термины подчеркивают генетические функции нуклеоида, но в то же время и существенные морфологические отличия от обычных интерфазных ядер эукариот, прежде всего, отсутствие ядерной оболочки, которая бы отделяла гены бактерии от окружающей их цитоплазмы. Исследование бактериальных клеток с помощью электронной микроскопии в мягких условиях без предварительной химической фиксации показало, что нуклеоиды представлены в виде диффузно окрашенных областей, свободных от рибосом (рис. I.1,а). При этом вытянутые участки ДНК на внешней части нуклеоидов направлены в окружающую цитоплазму. С помощью специфических антител установлено, что молекулы РНК-полимеразы, ДНК-топоизомеразы I и гистоноподобного белка HU ассоциированы с нуклеоидами. Вытянутые участки ДНК по периферии нуклеоидов обычно интерпретируют как сегменты бактериальной хромосомы, вовлеченные в транскрипцию. Полагают, что эти участки состоят из петель ДНК бактериальной хромосомы, которые в зависимости от физиологического состояния клетки находятся в транскрипционно-активном состоянии или втягиваются внутрь нуклеоидов при подавлении транскрипции. Модель функционально-активного нуклеоида А.Райтера и А.Чанга представлена на рис. I.1,б. По мнению авторов, размытая структура поверхности нуклеоидов, видимая под электронным микроскопом, отражает подвижное состояние активно транскрибируемых петель ДНК. В этой модели четко прослеживается аналогия со структурой хромосом типа ламповых щеток у животных.

Таким образом, нуклеоид бактериальных клеток не является статическим внутриклеточным образованием или компартментом, которые можно четко определять морфологически. Напротив, во время различных фаз роста бактериальных клеток нуклеоид непрерывно меняет форму, что, по-видимому, сопряжено с транскрипционной активностью определенных бактериальных генов. Так же как и в хромосомах эукариот, ДНК нуклеоида ассоциирована со многими ДНК-связывающими белками, в частности гистоноподобными белками HU, H-NS и IHF, а также топоизомеразами, которые оказывают большое влияние на функционирование бактериальных хромосом и их внутриклеточную компактизацию. Однако детальные молекулярные механизмы конденсации бактериальной ДНК с образованием лабильных "компактосом" (по аналогии со стабильными нуклеосомами эукариот) пока неизвестны. В последнее время возрастает интерес к бактериальному так называемому LP-хроматину (low protein chromatin), для которого характерно относительно низкое содержание белкового компонента. Аналогичный LP-хроматин обнаруживают у вирусов, в митохондриях, пластидах и у динофлагеллят (жгутиконосцев). Следовательно, этот тип структурной организации генетического материала претендует на универсальность и ассоциирован с определенными формами регуляции экспрессии генов, свойственными прокариотическим организмам.

В последние годы наблюдается прогресс в исследовании первичной структуры бактериальных хромосом. Определена полная последовательность нуклеотидов хромосом паразитических бактерий: микоплазмы Mycoplasma genitalium и Haemophilus influenzae. В 1997 г. усилиями интернационального коллектива ученых была определена полная первичная структура хромосом E. coli и Bacillus subtilis длиной в 4,6 и 4,2 млн п.о. соответственно Все это позволяет надеяться, что в ближайшее время произойдут новые открытия в области исследований структуры бактериальных геномов и функционирования их генов.

Геном архебактерий

Царство архебактерий представляет собой своеобразную и наименее изученную таксономическую группу прокариот. Хотя по своей морфологии Archeabacteria похожи на привычные эубактерии, на молекулярном уровне они сближены с эукариотами. Эти микроорганизмы часто рассматривают как прокариотические эволюционные предшественники эукариот, в связи с чем представляется целесообразным рассмотреть строение генома архебактерий более подробно.

Архебактерия Methanococcus jannaschii, первичная структура генома которой была полностью определена в 1996 г., обнаружена в горячих морских глубоководных источниках. Энергию для жизнедеятельности этот микроорганизм получает при восстановлении двуокиси углерода до метана молекулярным водородом. Температура, близкая к температуре кипящей воды, является оптимальной для его роста, который может происходить при давлении более 200 атм. M. jannaschii не требует для своего роста органических соединений: все необходимое для жизни он синтезирует из неорганических веществ – CO2, NH3 и т.п. Геном M. jannaschii состоит из основной кольцевой хромосомы и двух небольших внехромосомных элементов, размеры которых составляют соответственно 1700, 58 и 16 т.п.о. Подобные размеры геномов типичны для архе- и эубактерий. Интересно, что GC-состав ДНК этого ярко выраженного термофила невысок и составляет всего 31%. Геном организован компактно: обнаружено 1700 потенциальных кодирующих участков ДНК, по одному на каждые 1000 п.о.

Многие ДНК-локусы M. jannaschii не обнаруживают гомологии с уже известными последовательностями. Функциональное значение большого числа потенциальных кодирующих последовательностей генома этого микроорганизма остается невыясненным. Таким образом, M. jannaschii отличается от других прокариот и эукариот большим набором только ему свойственных генов и функций. Анализ структуры генома M. jannaschii показал, что гены, организующие системы обработки генетической информации – транскрипции, трансляции и репликации ДНК, в большей степени напоминают гены эукариот, чем бактерий. При этом гены системы трансляции оказались наиболее консервативными (обладали наибольшей гомологией) у прокариот, эукариот и архебактерий. Из них гены рРНК – универсальны, так же как и гены некоторых рибосомных белков. Специфические рибосомные белки M. jannaschii имеют гомологов у эукариот, но не у эубактерий. Большинство распознанных факторов трансляции у этой архебактерии также оказалось эукариотического типа. То же, хотя и в меньшей степени, относится к аминоацил-тРНК-синтетазам.

При сравнительном анализе генов системы транскрипции оказалось, что РНК-полимеразы M. jannaschii и эубактерий обнаруживают гомологию среди субъединиц, формирующих минимальный фермент, однако архебактерия обладает малыми дополнительными субъединицами, которые не свойственны эубактериям, а их гомологи имеются у РНК-полимераз эукариот. Лишь два из основных факторов транскрипции M. jannaschii гомологичны таковым эукариот, а один или два фактора рассматриваются, как "рудиментарные" формы соответствующих эукариотических факторов. Таким образом, система транскрипции архебактерий сегодня представляется как более простая и, возможно, более примитивная версия соответствующей эукариотической системы.

В геноме M. jannaschii найден только один ген, кодирующий ДНК-полимеразу, которая напоминает эукариотическую ДНК-полимеразу . ДНК-полимераза Pol III, осуществляющая репликацию ДНК у эубактерий, не имеет гомолога у M. jannaschii. Высокую гомологию с белками эукариот обнаруживают и другие белки архебактерии: гистоны, белки, контролирующие деление клетки, протеасомы, факторы элонгации трансляции, белки систем репарации и транспорта. Для M. jannaschii, как и для эубактерий, характерна организация генов в виде оперонов. Однако в первом случае опероны встречаются редко и почти всегда объединяют гены субъединиц белковых комплексов, например РНК-полимеразы, рибосом или метил-коэнзим М-редуктазы. В то же время довольно редки опероны, содержащие гены, объединенные по принципу контроля последовательных метаболических реакций. У M. jannaschii такие гены могут быть случайным образом распределены по геному.

Итак, несмотря на то что архебактерии образуют особое царство и по ряду своих генетических свойств приближаются к эукариотам, размер их генома и набор основных генов остаются типичными для свободно живущих бактерий.

Минимальный размер генома одноклеточных организмов

Определение минимального размера генома, обеспечивающего все необходимые функции, которые позволяют одноклеточному организму существовать в определенных экологических условиях, не является праздным вопросом. Решение этой проблемы необходимо для понимания происхождения жизни на Земле, а также путей и механизмов совместного эволюционирования генов, объединенных в конкретные геномы, а следовательно, и механизмов возникновения геномов как таковых. Данная проблема была впервые сформулирована Дж. Холдейном в 1920-е годы и с тех пор неоднократно исследовалась. Недавнее (1995 г.) определение полных первичных структур ДНК геномов двух паразитических микроорганизмов (Mycoplasma genitalium и Haemophilus influenzae) дало возможность использовать новый подход для изучения данной проблемы. А.Р. Мушегианом и Е.В. Куниным проведен детальный сравнительный анализ полного набора генов этих микроорганизмов, который позволил составить перечень генов, абсолютно необходимых для существования свободно живущих клеток.

Считается, что геномы M. genitalium и H. influenzae произошли путем последовательного уменьшения размера генома соответственно грамположительных и грамотрицательных бактерий-предшественников с более крупными геномами после отделения их предков от общего предшественника не менее 1,5 миллиардов лет назад. Предполагается, что общие гомологичные гены, сохранившиеся у этих микроорганизмов на протяжении столь длительного периода их существования, являются жизненно важными и составляют основу минимального набора генов, необходимых для автономного существования паразитических клеток. На основе анализа последовательностей нуклеотидов предсказано, что геном M. genitalium, длина которого составляет 580 т.п.о., кодирует 469 белков, тогда как геном H. influenzae (~1830 т.п.о.) кодирует 1703 белка. Оказалось, что геном M. genitalium содержит в своем составе 240 генов, имеющих функциональные гомологи в геноме H. influenzae. При теоретической разработке идеального абстрактного генома к набору было добавлено 22 гена, необходимых для осуществления жизненно важных метаболических процессов, которые у этих двух микроорганизмов контролировались негомологичными генами. Одновременно из набора были удалены 6 генов, избыточных с точки зрения выполняемых ими функций, которые обеспечивают специфическое взаимодействие микроорганизмов с хозяевами. Оставшиеся 256 генов, по мнению авторов теоретической разработки, полностью перекрывают потребности абстрактного паразитического микроорганизма. Предлагаемый гипотетический минимальный набор генов, кодирующих 256 белков, должен включать следующие жизненно важные генетические системы микроорганизмов: почти полный набор генов системы трансляции; почти полный набор генов системы репликации; гены рудиментарной системы репарации и рекомбинации; гены аппарата транскрипции, в котором отсутствуют почти полностью гены регуляции транскрипции; большой набор генов, кодирующих белки, гомологичные шаперонам; гены, контролирующие анаэробный метаболизм, включая гены гликолиза и фосфорилирования субстратов; гены биосинтеза липидов; восемь генов, кодирующих ферменты, которые используют сложные кофакторы; гены системы транспорта белков; ограниченный набор генов, обеспечивающий транспорт метаболитов; полный набор генов утилизации нуклеотидов de novo и гены их биосинтеза; гены биосинтеза аминокислот не включены (поскольку предполагается паразитический образ жизни).

Ранее были использованы еще два подхода для определения минимального размера генома, необходимого для автономного существования микроорганизмов. В одном из них путем введения случайных мутаций определялось число генетических локусов у Bacillus subtilis, несущественных для ее выживания. На основании результатов этих исследований сделан вывод о том, что средний размер минимального генома составляет 318 т.п.о., а его максимальный размер приближается к 562 т.п.о. Полученные значения согласуются с величинами, характерными для M. genitalium. При другом подходе изучались изменения размера генома при переходе от свободно живущих клеток к облигатным внутриклеточным паразитам и органеллам эукариот. При этом риккетсии рассматривались как эволюционные предшественники митохондрий. Работа еще не завершена, поскольку полной первичной структуры генома риккетсий пока не получено.

Таким образом, исследования, проведенные на геномах M.genitalium и H. influenzae, дают в настоящее время наиболее точную оценку минимального набора генов ( 250), необходимых для существования микроорганизмов. Эти результаты будут корректироваться по мере накопления экспериментальных данных о структуре других геномов, что позволит в каждом конкретном случае определять набор именно тех генов, которые делают любой организм уникальным и неповторимым.

  1.  Геном эукариот

Как уже упоминалось выше, в отличие от прокариот основная часть генома эукариот находится в специальном клеточном компартменте (органелле), получившем название ядра, а значительно меньшая часть – в митохондриях, хлоропластах и других пластидах. Так же, как и у прокариот, информационной макромолекулой генома эукариот является ДНК, которая неравномерно распределена по нескольким хромосомам в виде комплексов с многочисленными белками. Эти ДНК-белковые комплексы эукариот получили название хроматина. На протяжении клеточного цикла хроматин претерпевает высокоупорядоченные структурные преобразования в виде последовательных конденсаций–деконденсаций. В соматических клетках при максимальной конденсации в метафазе митоза эти преобразования сопровождаются формированием видимых в микроскопе метафазных хромосом. Как морфология метафазных хромосом, так и их число являются уникальными характеристиками вида. Совокупность внешних признаков хромосомного набора эукариот получила название кариотипа. Эти признаки широко используются в биологической систематике.

Геном эукариот существенно отличается от генома прокариот по ряду признаков, среди которых необходимо отметить его избыточность. Содержание ДНК у эукариот в расчете на одну клетку в среднем на два–три порядка выше, чем у прокариот, и у разных видов животных изменяется от 168 пг (амфибии) до 1 пг (некоторые виды рыб). У человека имеется  6 пг ДНК на диплоидный геном, суммарная длина которой приближается к 6·109 п.о. (см. табл. I.1).

Повышенное содержание ДНК в геноме эукариот нельзя объяснить одним лишь увеличением потребности этих организмов в дополнительной генетической информации в связи с усложнением организации, поскольку большая часть их геномной ДНК, как правило, представлена некодирующими последовательностями нуклеотидов. Размер генома организмов, находящихся на более низких ступенях эволюционного развития, зачастую превышает размеры геномов более высокоорганизованных животных и растений. В настоящее время известно, что большая часть ДНК генома эукариот не кодирует РНК и белки, и ее генетические функции не вполне понятны. Особенности первичной структуры ДНК эукариот позволяют разделить ее на многочисленные семейства и классы, основные из которых кратко рассмотрены ниже.

  1.  Последовательности нуклеотидов эукариотического генома

Геном эукариот составляют уникальные и повторяющиеся последовательности нуклеотидов. Содержание уникальных последовательностей в геноме, определенное на основании кинетики реассоциации фрагментированной ДНК, варьирует у разных организмов, и их доля составляет 15–98% от всей ДНК. Несмотря на то, что во фракцию уникальных последовательностей попадают многие структурные гены, большая часть уникальных последовательностей является некодирующей и обычно не заключает в себе генетической информации в общепринятом значении этого термина: не кодирует функционально значимые полипептидные цепи или РНК. Хорошо известным примером таких уникальных последовательностей являются интроны, общий размер которых, как правило, на порядок и более превышает суммарный размер экзонов содержащих их генов.

Эволюционное возникновение мозаичной (интрон–экзонной) структуры генов эукариот, так же как и консервативный характер наследования размеров и взаимного расположения интронов в генах, не находит в настоящее время исчерпывающего объяснения из-за кажущегося отсутствия фактора давления естественного отбора на последовательности нуклеотидов без четких биологических функций. Наибольшее распространение получила концепция В. Гилберта (1977 г.), согласно которой появление интронов, по-видимому, совпавшее по времени с эволюционным возникновением многоклеточных организмов, обеспечило возможность обмена экзонами между неродственными генами (exon shuffling). Такой обмен должен сопровождаться образованием новых белков мозаичного строения, составленных из готовых полипептидных функционально значимых модулей (доменов), ранее принадлежавших другим белкам. Следствием этого, по мнению сторонников данной концепции, было резкое ускорение образования белков и ферментов с новыми функциями, а также глубокие эволюционные преобразования самих организмов, реализующих такие молекулярные механизмы. Эта точка зрения получила название "гипотезы позднего возникновения интронов" (intron late). В соответствии с другой гипотезой Дж.Е. Дарнелла и В.Ф. Дулиттла (1978 г.) современные интроны представляют собой "эволюционные реликты". Когда-то интроны были частью гигантских генов.

Не менее загадочным с эволюционной точки зрения остается и феномен появления в геноме многоклеточных организмов большого количества некодирующих повторяющихся последовательностей. Такие повторы представлены в гаплоидном геноме эукариот множественными копиями. В современной классификации повторов принято различать часто повторяющиеся последовательности, число которых превышает 105 на гаплоидный геном, и умеренно повторяющиеся, представленные 10–104 копиями. Хорошо изученным представителем первых является сателлитная ДНК, которая состоит из коротких тандемных повторов длиной 1–20 п.о., организованных в длинные блоки. Одними из первых среди повторяющихся последовательностей ДНК эукариот были открыты сателлитные ДНК тимуса телят. Свое название они получили на основании того, что при анализе суммарной эукариотической ДНК центрифугированием в градиенте плотности хлористого цезия они сопровождали основной пик оптической плотности в виде плеча (спутника, сателлита). Именно гомогенный нуклеотидный состав фракции сателлитных ДНК, определяемый наличием в ней многочисленных коротких повторов, изменял ее плавучую плотность, что легко обнаруживалось при центрифугировании. В своем классическом определении сателлитных ДНК Р.Д. Бриттен и соавт. (1974 г.) отмечали, что сателлиты – это минорный компонент ДНК, отделяющийся от основной ДНК при равновесном ультрацентрифугировании в градиенте плотности CsCl. Для сателлитов характерен ряд свойств, среди которых наиболее важны: а) быстрая и точная реассоциация в процессе ренатурации ДНК; б) множество копий; в) простая первичная структура; г) гомогенный состав (протяженные кластеры одних и тех же повторяющихся блоков последовательны); д) пурин–пиримидиновая асимметрия в распределении нуклеотидов по цепям ДНК; е) концентрирование в прицентромерном гетерохроматине; ж) ограниченная репликация (недорипликация) при политенизации хромосом; з) нахождение в составе хромосом в виде тандемно (друг за другом) расположенных кластеров. Содержание сателлитной ДНК в геноме эукариот может достигать 5–50% от суммарного количества ДНК. Микро- (от 1 до 4 п.о. в основном повторяющемся блоке) и минисателлитные (с бóльшим числом п.о. в индивидуальном повторе) ДНК характеризуются высокой вариабельностью по числу копий в геномах организмов даже одного вида и в ряде случаев обладают генетической нестабильностью как в норме, так и при некоторых патологических состояниях организмов. Благодаря этому свойству мини- и микросателлиты часто называют тандемными повторами с изменяющимся числом копий VNTR (variable number of tandem repeats).

Другой тип повторов – диспергированные повторяющиеся последовательности ДНК, не организованные в крупные блоки, а рассеянные по геному. Повторы этого типа, иначе называемые умеренно повторяющимися последовательностями (medium reiterated frequency repeatsMERs), разделяют на два обширных класса: SINE (short interspersed elements) – короткие и LINE (long interspersed elements) – длинные диспергированные элементы. Длина SINE-элементов составляет 90–400 п.о., тогда как длина LINE-последовательностей может достигать 7 т.п.о. Хорошо изученными повторами класса SINE в геноме человека и некоторых приматов являются так называемые Alu-повторы, длина повторяющейся единицы которых составляет 300 п.о. Alu-повторы представлены в геноме человека ~106 копиями и в среднем встречаются через каждые 4 т.п.о., составляя ~5% от суммарного количества ДНК. Аналогичные в структурном отношении повторы, названные B1, обнаружены в геноме мышей и под другими названиями описаны у многих млекопитающих.

Хотя LINE-последовательности заключают в себе гены обратных транскриптаз, что является признаком ретротранспозонов (мобильных генетических элементов животных, обладающих структурным сходством с геномом ретровирусов), для них характерно отсутствие последовательностей длинных концевых повторов (long terminal repeats – LTR), типичных для ретротранспозонов (подробнее о геноме ретровирусов см. раздел 7.2.7). В качестве примера LINE-последовательности можно упомянуть LINE-1-повтор, широко распространенный в геноме животных. LINE-1-элемент мышей содержит две открытые рамки считывания ORF-1 и ORF-2, вторая из которых кодирует белок, гомологичный обратной транскриптазе. ORF фланкированы короткими нетранслируемыми последовательностями, а сами LINE-1 – короткими прямыми повторами (SDR). 5’-Концевые последовательности повтора функционируют в качестве промоторов транскрипции. Этот участок LINE-1 грызунов (но не человека) построен из коротких тандемных повторов двух типов A и F, называемых мономерами. Длина мономеров у крыс составляет 600 п.о. При этом A- (но не F) мономеры обладают активностью промоторов.

Так же как и сателлитные ДНК, SINE- и LINE-повторы характеризуются генетической нестабильностью. Их общими чертами являются транскрибируемость и способность к транспозициям. Последовательности РНК, транскрибированные с умеренных повторов, обнаруживают среди гетерогенных ядерных РНК, где их доля достигает 20–30%. Имеются экспериментальные свидетельства того, что новые копии повторяющихся элементов обоих типов возникают в геноме в результате функционирования механизма, названного ретротранспозицией, или ретропозицией. При участии подобного механизма под действием обратной транскриптазы сначала образуется кДНК на матрице РНК-транскрипта соответствующего повтора, которая далее интегрируется в новый локус генома, как это имеет место у ретровирусов. Такой механизм дает возможность локально изменять число копий определенных последовательностей нуклеотидов в эукариотическом геноме. Тем не менее, большая часть LINE-последовательностей неспособна к транспозициям, и их ORF, по-видимому, могут быть отнесены к псевдогенам – неэкспрессирующимся последовательностям, гомологичным последовательностям истинных генов. Помимо вышеупомянутых повторяющихся последовательностей геном человека содержит более 100 000 копий MaLR-повторов длиной в 2–3 т.п.о., содержащих LTR, и несколько тысяч последовательностей генома ретровирусов.

Несмотря на широкую распространенность повторяющихся и уникальных некодирующих последовательностей в геноме эукариот и их очевидную активность во время жизненного цикла организмов, биологическое значение этих и других некодирующих элементов генома остается непонятным. Вызывает сомнение правильность активно обсуждаемой в литературе гипотезы об "эгоистичности" избыточной геномной ДНК, в соответствии с которой вся избыточная ДНК является геномным паразитом и распространяется в геноме в результате транспозиций точных копий немногочисленных исходных последовательностей. Действительно, слишком велики были бы энергетические затраты на биосинтез предшественников ДНК и самой ДНК в клетках, в которых содержание "паразитической" ДНК в геноме на 2–3 порядка превышает количество функционально значимой ДНК, заключающей в себе последовательности нуклеотидов генов. Клетки с геномом, "зараженным" эгоистической ДНК, не смогли бы выдерживать конкуренции с клетками, не содержащими "паразита", из-за значительного возрастания энергетических затрат на редупликацию генома. Кроме того, концепция эгоистической ДНК, в соответствии с которой предполагается отсутствие эволюционного давления отбора на "паразитические" последовательности нуклеотидов, не объясняет высокую консервативность мест локализации и размеров интронов в гомологичных генах филогенетически близких организмов, а также не указывает на механизм, поддерживающий число копий повторов на относительно постоянном уровне в ряду поколений организмов. Такого рода концепции не могут ответить на вопрос: где же предел, до которого может самопроизвольно увеличиваться размер генома клетки-хозяина в филогенезе?

Функциональную значимость избыточной ДНК лишь частично объясняют концепции, приписывающие ей структурную роль в пространственной организации генома и участие в конъюгации гомологичных хромосом в мейозе или репликации теломерных участков хромосом. Таким образом, основные положения знаменитого парадокса C, указывающие на необъяснимое присутствие в геноме эукариотических организмов большого количества избыточной ДНК, по-прежнему остаются загадочными и парадоксальными. Попытка нового объяснения основной функциональной роли "избыточной" ДНК в геноме эукариот сделана в разделе 5.3.

  1.  Хроматин

Хроматином называют сложную смесь веществ, из которых построены хромосомы эукариот. Основными компонентами хроматина являются ДНК, гистоны и негистоновые белки, образующие высокоупорядоченные в пространстве структуры. Соотношение ДНК и белка в хроматине составляет ~1:1, а основная масса белка хроматина представлена гистонами. Гистоны образуют семейство высококонсервативных основных белков, которые разделяются на пять больших классов, названных H1, H2A, H2B, H3 и H4. Размер полипептидных цепей гистонов лежит в пределах ~220 (H1) и 102 (H4) аминокислотных остатков. Гистон H1 сильно обогащен остатками Lys, для гистонов H2A и H2B характерно умеренное содержание Lys, полипептидные цепи гистонов H3 и H4 богаты Arg. Внутри каждого класса гистонов (за исключением H4) на основании аминокислотных последовательностей различают несколько субтипов этих белков. Такая множественность особенно характерна для гистонов класса H1 млекопитающих. В этом случае различают семь субтипов, названных H1.1–H1.5, H1o и H1t.

Важным результатом взаимодействия ДНК с белками в составе хроматина является ее компактизация. Суммарная длина ДНК, заключенной в ядре клеток человека, приближается к 1 м, тогда как средний диаметр ядра составляет 10 мкм. Длина молекулы ДНК, заключенной в одной хромосоме человека, в среднем равняется ~4 см. В то же время длина метафазной хромосомы составляет ~4 мкм. Следовательно, ДНК метафазных хромосом человека компактизована по длине, по крайней мере, в 104 раз. Степень компактизации ДНК в интерфазных ядрах значительно ниже и неравномерна в отдельных генетических локусах. С функциональной точки зрения различают эухроматин и гетерохроматин. Эухроматин характеризуется меньшей по сравнению с гетерохроматином компактизацией ДНК, и в нем главным образом локализуются активно экспрессирующиеся гены. В настоящее время широко распространено мнение о генетической инертности гетерохроматина. Поскольку его истинные функции сегодня нельзя считать установленными, эта точка зрения по мере накопления знаний о гетерохроматине может измениться. Уже сейчас в нем находят активно экспрессирующиеся гены.

Гетерохроматизация определенных участков хромосом часто сопровождается подавлением транскрипции имеющихся в них генов. В процесс гетерохроматизации могут быть вовлечены протяженные участки хромосом и даже целые хромосомы. В соответствии с этим считается, что регуляция транскрипции генов эукариот в основном происходит на двух уровнях. На первом из них компактизация или декомпактизация ДНК в хроматине может приводить к длительной инактивации или активации протяженных участков хромосом или даже целых хромосом в онтогенезе организма. Более тонкая регуляция транскрипции активированных участков хромосом достигается на втором уровне при участии негистоновых белков, включающих многочисленные факторы транскрипции.

Структурная организация хроматина и хромосом эукариот. Вопрос о структурной организации хроматина в интерфазных ядрах в настоящее время далек от своего разрешения. Это связано, прежде всего, со сложностью и динамичностью его структуры, которая легко меняется даже при незначительных экзогенных воздействиях. Большинство знаний о структуре хроматина было получено in vitro на препаратах фрагментированного хроматина, структура которого значительно отличается от таковой в нативных ядрах. В соответствии с распространенной точкой зрения различают три уровня структурной организации хроматина у эукариот: 1) нуклеосомная фибрилла; 2) соленоид, или нуклеомер; 3) петельно-доменная структура, включающая хромомеры.

Нуклеосомные фибриллы. В определенных условиях (при низкой ионной силе и в присутствии двухвалентных ионов металлов) в изолированном хроматине удается наблюдать регулярные структуры в виде протяженных фибрилл диаметром 10 нм, состоящих из нуклеосом. Эти фибриллярные структуры, в которых нуклеосомы расположены как бусы на нитке, рассматриваются в качестве низшего уровня упаковки ДНК эукариот в хроматине. Нуклеосомы, входящие в состав фибрилл, расположены более или менее равномерно вдоль молекулы ДНК на расстоянии 10–20 нм друг от друга. В состав нуклеосом входят четыре пары молекул гистонов: H2a, H2b, H3 и H4, а также одна молекула гистона H1. Данные по структуре нуклеосом в основном получены с использованием трех методов: рентгеноструктурного анализа низкого и высокого разрешения кристаллов нуклеосом, межмолекулярных сшивок белок–ДНК и расщепления ДНК в составе нуклеосом с помощью нуклеаз или радикалов гидроксила. На основании таких данных А. Клугом была построена модель нуклеосомы, в соответствии с которой ДНК (146 п.о.) в B-форме (правозакрученная спираль с шагом 10 п.о.) намотана на гистоновый октамер, в центральной части которого расположены гистоны Н3 и Н4, а на периферии – Н2а и Н2b. Диаметр такого нуклеосомного диска составляет 11 нм, а его толщина – 5,5 нм. Структура, состоящая из гистонового октамера и намотанной на него ДНК, получила название нуклеосомной кóровой частицы. Кóровые частицы отделены друг от друга сегментами линкерной ДНК. Общая длина участка ДНК, включенного в нуклеосому животных, составляет 200 (15) п.о.

Полипептидные цепи гистонов содержат структурные домены нескольких типов. Центральный глобулярный домен и гибкие выступающие N- и С-концевые участки, обогащенные основными аминокислотами, получили название плеч (arm). С-концевые домены полипептидных цепей, участвующие в гистон–гистоновых взаимодействиях внутри кóровой частицы, находятся преимущественно в виде -спирали с протяженным центральным спиральным участком, вдоль которого с двух сторон уложено по одной более короткой спирали. Все известные места обратимых посттрансляционных модификаций гистонов, происходящих на протяжении клеточного цикла или во время дифференцировки клеток, локализованы в гибких основных доменах их полипептидных цепей (табл. I.2). При этом N-концевые плечи гистонов H3 и H4 являются самыми консервативными участками молекул, а гистоны в целом – одними из наиболее эволюционно консервативных белков. С помощью генетических исследований дрожжей S. cerevisiae было установлено, что небольшие делеции и точковые мутации в N-концевых частях генов гистонов сопровождаются глубокими и разнообразными изменениями фенотипа дрожжевых клеток. Это указывает на чрезвычайную важность целостности молекул гистонов в обеспечении правильного функционирования эукариотических генов.

В растворе гистоны Н3 и Н4 могут существовать в виде стабильных тетрамеров (Н3)2(Н4)2, а гистоны Н2А и Н2В – в виде стабильных димеров. Постепенное повышение ионной силы в растворах, содержащих нативный хроматин, приводит к освобождению сначала димеров Н2А/Н2В, а затем тетрамеров Н3/Н4.

Дальнейшее уточнение тонкой структуры нуклеосом в кристаллах было проведено недавно в работе К. Люгера с соавт. (1997 г.) с помощью рентгеноструктурного анализа высокого разрешения. Было установлено, что выпуклая поверхность каждого гистонового гетеродимера в составе октамера огибается сегментами ДНК длиной 27–28 п.о., расположенными по отношению друг к другу под углом 140о, которые разделены линкерными участками длиной в 4 п.о.

В соответствии с современными данными пространственная структура ДНК в составе кóровых частиц несколько отличается от B-формы: двойная спираль ДНК перекручена на 0,25–0,35 п.о./виток двойной спирали, что приводит к образованию шага спирали, равному 10,2 п.о./виток (у В-формы в растворе – 10,5 п.о./виток). Стабильность комплекса гистонов в составе кóровой частицы определяется взаимодействием их глобулярных частей, поэтому удаление гибких плеч в условиях мягкого протеолиза не сопровождается разрушением комплекса. N-концевые плечи гистонов, по-видимому, обеспечивают их взаимодействие со специфическими участками ДНК. Так, N-концевые домены гистона Н3 контактируют с участками ДНК на входе в кóровую частицу и выходе из нее, тогда как соответствующий домен гистона Н4 связывается с внутренней частью ДНК нуклеосомы.

Упомянутые выше исследования структуры нуклеосом высокого разрешения показывают, что центральная часть сегмента ДНК длиной в 121 п.о. в составе нуклеосомы образует дополнительные контакты с гистоном H3. При этом N-концевые части полипептидных цепей гистонов H3 и H2B проходят через каналы, образуемые малыми бороздками соседних супервитков ДНК нуклеосомы, а N-концевая часть гистона H2A контактирует с малой бороздкой внешней части супервитка ДНК. В совокупности данные высокого разрешения показывают, что ДНК в составе коровых частиц нуклеосом огибает гистоновые октамеры неравномерно. Кривизна нарушается в местах взаимодействия ДНК с поверхностью гистонов, и такие изломы наиболее заметны на расстоянии 10–15 и 40 п.о. от центра супервитка ДНК.

 

Таблица I.2

Свойства гистонов животных

Гистон

Размер полипептида

(число аминокислот)

Локализация и типы посттрансляционных модификаций

Вся молекула

N-концевое плечо

С-концевое плечо

Н3

135

41

25

Ac-K9, P-S10, Ac-K-14, Ac-K18, Ac-K23, Ac-K27

H4

102

32

P-S1, Ac-K5, Ac-K8, Ac-K12,

Ac-K16, Ac-K20

H2A

129

24

16

P-S1, Ac-K5, Ac-K9

H2B

125

30

23

Ac-K12, Ac-K15, Ac-K20, Ac-K24, P-S32, P-S36

H1

213

36

92

S-фаза: P-S145, P-S173, P-S180

Митоз: P-S16, P-T17, P-T136,

P-S145, P-S173, P-S180

Примечание. Ac – ацетилирование, P – фосфорилирование; K, R, T и S – остатки Lys, Arg, Thr и Ser соответственно. Цифры обозначают положение соответствующих аминокислотных остатков в полипептидных цепях.

 

Структура фибриллы хроматина типа "бусин на нитке" наблюдается in vitro при очень низкой ионной силе и в отсутствие двухвалентных катионов или же без гистона Н1 даже при физиологических концентрациях солей. При повышении ионной силы в присутствии гистона Н1, который выполняет функции конденсирующего агента, в хроматине происходит структурный переход, сопровождающийся формированием равномерной фибриллы диаметром 30 нм, в которой нуклеосомы располагаются вплотную друг к другу. Предполагается, что именно такая структура хроматина на этом уровне конденсации преобладает in vivo.

В ядрах ДНК в основном входит в состав фибрилл диаметром 25~30 нм, которые образуются и в растворах с физиологическими концентрациями солей (100 мМ NaCl), содержащих изолированный хроматин. Такие фибриллы в форме соленоида неравномерны по своей длине. С помощью электронного микроскопа в них обнаруживаются гранулы диаметром 30 нм, между которыми находятся более тонкие участки. Ю.С. Ченцов, впервые обнаруживший эти гранулы, назвал их нуклеомерами, позднее они были описаны в литературе под названием "супербидов" (super-beads). Согласно модели А. Клуга, на один шаг (10 нм) соленоида приходится 6 нуклеосом, что приводит к уменьшению в ~6 раз длины фибриллы диаметром в 10 нм, а исходной свободной ДНК – в 40 раз. Таким образом, в соответствии с этой упрощенной картиной цепь нуклеосом на втором уровне упаковки хроматина свернута в симметрично построенный соленоид, содержащий нуклеомеры. Симметрия соленоида нарушается при взаимодействии с ним негистоновых белков.

Энергия, необходимая для образования соленоида, частично черпается из энергии взаимодействия нуклеосом друг с другом. Однако основной вклад в этот процесс вносит гистон Н1, связывание молекул которого с линкерной ДНК за пределами кóровых частиц обеспечивает образование компактных фибрилл диаметром 30 нм. Дифференцирующиеся клетки высших эукариот обладают способностью к синтезу целого семейства гистонов Н1, например Н1А, Н1В, Н1о, которые имеют структурное сходство с гистоном Н5, обнаруженным в дифференцирующихся предшественниках эритроцитов. Полипептидные цепи гистонов семейства Н1, как и молекулы гистонов кóровых частиц, содержат центральный глобулярный домен и два гибких плеча. Глобулярный домен определяет локализацию гистона Н1 в нуклеосомах, где он взаимодействует с ДНК в месте ее входа в кóровую частицу и выхода из нее, стабилизируя два отрицательных супервитка ДНК, обернутой вокруг гистонового октамера. Расщепление хроматина нуклеазой микрококков приводит к освобождению гистона Н1, так как при этом происходит отщепление сегментов ДНК, с которыми он взаимодействует.

Следует подчеркнуть, что точная структура соленоида в настоящее время неизвестна. Данные, недавно полученные методом рассеивания нейтронов, указывают на то, что гистон Н1 локализован внутри хроматиновой фибриллы и на ее поперечном срезе помещается шесть нуклеосом, что хорошо соответствует модели Клуга. Однако при изучении хроматина с помощью сканирующей микроскопии было установлено, что при низкой ионной силе соленоид существует в виде нерегулярной спирали.

Петельно-доменный уровень компактизации хроматина. В интерфазных ядрах эукариот нити хроматина, в которых ДНК упакована в форме соленоида, содержащего нуклеомеры, организованы в виде топологически независимых петель, длина которых в среднем составляет 50–100 т.п.о. Такой способ пространственной укладки нитей хроматина рассматривается как следующий уровень конденсации хроматина (и ДНК) у эукариот, а сами петли получили название хромомеров. С помощью электронного микроскопа обнаружено, что нити хроматина в хромомерах имеют дополнительную специфическую укладку в виде розеток, собранных у основания, от которого отходят малые петли длиной ~5 т.п.о. (см. рис. I.2). Образование хромомеров становится возможным благодаря наличию у их оснований определенных последовательностей нуклеотидов, которые специфически взаимодействуют с ядерным матриксом, называемым иначе ядерным скэффолдом (скелетом) – сетчатообразной структурой внутри интерфазных ядер, образованной белками и РНК. Эти участки хромосомной ДНК, взаимодействующие с ядерным матриксом, в литературе известны под сокращенными названиями MAR (Matrix Associated Region) или SAR (Scaffold Associated Region) и часто обозначаются как MAR/SAR-последовательности.

Были предприняты попытки связать локализацию MAR/SAR-последовательностей на ДНК с функциональной активностью хроматина. Исследование петельной структуры хроматина в ядрах дрозофилы показало, что эти последовательности часто располагаются в окрестностях генов, транскрибируемых РНК-полимеразой II, и фланкируют участки хроматина, содержащие одну или несколько транскрипционных единиц. Выяснилось, что активно транскрибируемые гены организованы в петли небольшого размера (10 т.п.о.), тогда как "молчащие" гены находятся преимущественно в составе более крупных петель, которые содержат несколько транскрипционных единиц и, в свою очередь, образуют дополнительные петли в виде розеток (см. рис. I.2). Как правило, MAR/SAR-последовательности фланкируют гены, однако в ряде случаев их обнаруживают и внутри генов, но в составе интронов. В настоящее время выделено и охарактеризовано несколько десятков MAR/SAR-последовательностей из генома дрозофилы и других организмов. У дрозофилы они представляют собой АТ-богатые последовательности нуклеотидов длиной в 200–350 п.о., в составе которых часто встречаются участки поли(dA)поли(dT). Обнаружены два типа блоков из АТ-богатых последовательностей: А-блок – AATAAAT/CAAA и Т-блок – TTA/TTT/ATTT/CAAA, характерные для всех MAR/SAR-последовательностей не только дрозофилы, но и других организмов. Отличающиеся от них блоки похожих последовательностей нуклеотидов – ATATTT и AATATTTT, первоначально найденные в MAR/SAR-последовательностях мышей, оказались широко представленными и в аналогичных последовательностях многих эукариот.

Можно выделить следующие обобщенные  характеристики MAR/SAR-последовательностей, приведенные в недавнем обзоре М.В. Глазкова (1995 г.):

длина MAR/SAR-последовательностей составляет 300–1000 п.о.; все они содержат многочисленные сайты ДНК-белкового взаимодействия и обогащены AT-парами;

MAR/SAR-последовательности обладают способностью обратимо связываться с ядерным матриксом метафазных хромосом и локализованы исключительно в некодирующих последовательностях генома, главным образом в нетранскрибируемых участках, реже в интронах;

расстояние между двумя соседними MAR/SAR-последовательностями составляет 3–112 т.п.о., и они фланкируют один или несколько экспрессирующихся генов, для которых характерна повышенная чувствительность к нуклеазам из-за деконденсированного состояния их хроматина;

некоторые MAR/SAR-последовательности выявлены рядом с энхансероподобными регуляторными элементами. Кроме того, эти последовательности могут быть потенциальными сайтами инициации репликации и содержать в своем составе большое число сайтов для разных факторов транскрипции;

MAR/SAR-последовательности иногда соседствуют с последовательностями, способными образовывать Z- или H-формы ДНК, и в таких случаях они определяются как сайты с повышенной чувствительностью к ДНКазе I.

Все это указывает на то, что MAR/SAR-последовательности являются чрезвычайно важными в функциональном отношении последовательностями геномной ДНК эукариот. Одной из основных функций, которую им приписывают в настоящее время, может быть пространственное разграничение функциональных доменов хроматина в интерфазных ядрах эукариот, необходимое для эффективной и независимой экспрессии генов, находящихся в этих доменах. Подробнее о выполнении MAR/SAR-последовательностями функций пограничных последовательностей (инсуляторов), регулирующих экспрессию эукариотических генов, см. в разделе 3.2.4.

Являясь одними из ключевых цис-действующих генетических регуляторных элементов хромосом эукариот, MAR/SAR-последовательности осуществляют глобальный контроль изменений структуры хроматина и связанных с ними модуляций экспрессии генов на уровне транскрипции. В настоящее время считается, что эти последовательности обеспечивают поддержание функциональной структуры хромосом в интерфазных ядрах и вовлечены в процесс их конденсации при формировании метафазных хромосом во время митоза. Современная модель структуры метафазной хромосомы К.М. Харта и У.К. Лэммли (1998 г.) подчеркивает, что SAR-последовательности, пространственно примыкая друг к другу, образуют ось хроматиды, от которой в разные стороны отходят петли хроматина, формирующие тело метафазной хромосомы. Однако еще остается доказать, являются ли MAR/SAR-последовательности местами специфического прикрепления белковых комплексов, включающих, к примеру, белок конденсин, которые необходимы для конденсации хроматина.

Негистоновые белки хроматина. Большое влияние на структуру хроматина и функционирование эукариотических генов оказывают различные негистоновые белки. В ядрах в наибольшем количестве обнаруживают негистоновые белки, которые относят к так называемой группе белков с высокой подвижностью (high mobility group – HMG). Это название отражает их высокую подвижность при электрофорезе. Суммарное содержание HMG-белков в ядрах клеток в ~10 раз меньше, чем гистонов. Эти белки разделяют на три основных подкласса: 14/17, 1/2 и I/Y.

HMG 14/17 представляют собой небольшие белки с молекулярной массой 10–12 кДа, полипептидные цепи которых несут большой локальный электрический заряд при физиологических значениях рН. N-Концевые части их полипептидных цепей обладают основными свойствами, тогда как С-концевые – кислыми. Кóровые частицы нуклеосом содержат на своей поверхности две молекулы HMG 14/17, которые соединяют между собой цепи ДНК двух соседних витков. HMG-Белки этой  группы могут замещать гистон H1 в активно транскрибируемых генах. In vivo ~10% коровых частиц нуклеосом могут содержать белки HMG 14/17.

Белки группы HMG 1/2 также являются одними из преобладающих ядерных белков с молекулярной массой 25–30 кДа. Эти белки специфически связываются с одноцепочечными участками ДНК, а также участками ДНК, образующими крестообразные структуры в местах, содержащих палиндромные последовательности. Это указывает на их возможное участие в процессах рекомбинации, репарации и(или) репликации. Было показано, что белки HMG 1/2 способствуют сборке нуклеосом in vitro, однако физиологическое значение этого факта остается непонятным, поскольку многие отрицательно заряженные молекулы в экспериментальных условиях также ускоряют образование нуклеосом.

Белки HMG I/Y преимущественно взаимодействуют с АТ-богатыми участками ДНК, что характерно и для гистона Н1. Предполагается, что эти белки конкурируют с гистоном Н1 in vivo за промоторы и области начала репликации ДНК (см. разделы 2.1 и 4.1).

Помимо HMG-белков к негистоновым белкам хроматина относятся многочисленные внутриядерные ферменты и белковые факторы, необходимые для работы генетического аппарата клетки. Многим из этих белков, обеспечивающим транскрипцию, репарацию и репликацию, посвящены целые разделы этой книги. Среди негистоновых белков особое место занимают ДНК-топоизомеразы, механизмы функционирования которых целесообразно рассмотреть отдельно.

  1.  Роль ДНК-топоизомераз в обеспечении структуры и функционирования хроматина

Топоизомеразы контролируют в клетках уровень суперскрученности ДНК, который может изменяться в процессе ее репликации, транскрипции, гомологичной рекомбинации, а также во время перестроек хроматина. Все эти ферменты релаксируют суперскрученные молекулы ДНК, снимая их внутреннее напряжение путем внесения одно- или двухцепочечных разрывов с последующим их восстановлением (лигированием). По механизму действия различают ДНК-топоизомеразы типа I и II. ДНК-топоизомеразы I, которые являются мономерными белками, релаксируют ДНК без затраты энергии путем внесения одноцепочечных разрывов. В отличие от этого, ДНК-топоизомеразы II функционируют в виде димеров, осуществляя ATP-зависимое расщепление обеих цепей ДНК с последующим переносом цепей через разрыв и его лигированием (рис. I.3).

Для внесения одноцепочечного разрыва в ДНК все ДНК-топоизомеразы используют остаток Tyr, который осуществляет нуклеофильную атаку фосфатной группы ДНК с образованием фосфотирозина. В результате ферменты оказываются ковалентно связанными с 5'- или 3'-концами ДНК в одноцепочечном разрыве. Образование такой ковалентной связи исключает необходимость затраты энергии при восстановлении фосфодиэфирной связи в одноцепочечном разрыве на заключительных стадиях реакции. У ДНК-топоизомераз типа I имеется один каталитический остаток Tyr на молекулу мономерного белка, тогда как димеры ДНК-топоизомераз II содержат по одному каталитическому остатку на каждую субъединицу, что обеспечивает создание ступенчатого двухцепочечного разрыва в молекуле релаксируемой ДНК.

Обнаружены, по крайней мере, два подтипа ДНК-топоизомераз IIA и IB, которые, будучи неродственными ферментами как по первичной, так и по пространственной структурам, выполняют аналогичные функции с помощью различных механизмов. До недавнего времени ДНК-топоизомеразы IA считали исключительно прокариотическими ферментами, однако они были найдены и в клетках эукариот, включая клетки человека, и названы ДНК-топоизомеразами III.

ДНК-топоизомераза IA релаксирует ДНК, содержащие только отрицательные супервитки, работает в присутствии ионов Mg2+ и ковалентно соединяется с 5'-концами ДНК в образующихся врéменных одноцепочечных разрывах. Это сближает ДНК-топоизомеразы IA и II между собой, что было подтверждено также структурными исследованиями. В отличие от этого, ДНК-топоизомеразы IB способны релаксировать ДНК как с положительными, так и отрицательными супервитками, не требуют для своего функционирования ионов металлов и взаимодействует ковалентно с 3'-концами ДНК. ДНК-топоизомеразы IB найдены исключительно в клетках эукариот (за единственным исключением вируса вакцины).

В клетках человека ДНК-топоизомераза IB/III специфически ингибируется камптотецином (camptothecin), который в настоящее время рассматривается в качестве перспективного противоопухолевого препарата. Это соединение взаимодействует преимущественно с ковалентным комплексом топоизомераза I–ДНК, что подавляет реакцию восстановления фосфодиэфирной связи и освобождение фермента из комплекса. В результате происходит быстрое накопление двухцепочечных разрывов ДНК и вступление клеток в апоптоз.

ДНК-топоизомераза II является жизненно важным ферментом любого эукариотического организма. Кроме релаксации суперскрученных молекул ДНК она может осуществлять образование или развязывание узлов, а также образование или разделение катенанов (кольцевых замкнутых ДНК, сцепленных друг с другом). Реакции развязывания узлов и разделения катенанов являются прерогативой именно ДНК-топоизомеразы II и не выполняются ДНК-топоизомеразами I.

У дрожжей ДНК-топоизомераза II требуется для разделения катенанов сестринских хроматид хромосом в анафазе митоза и абсолютно необходима для сегрегации хромосом в мейозе, а также конденсации хроматина в процессе формирования метафазных хромосом. Выяснена важная роль ДНК-топоизомеразы II и в формировании высших уровней структуры хроматина, а именно участие фермента в образовании петель хроматина во время конденсации хромосом.

ДНК-топоизомераза II локализована в ядре и в больших количествах ассоциируется с ДНК как в интерфазных, так и метафазных ядрах. С помощью специфических антител показано, что молекулы фермента располагаются преимущественно вдоль центральной продольной оси обоих плеч хромосом у многих организмов. Такое аксиальное распределение ДНК-топоизомеразы II в хромосомах наблюдали даже после удаления из них большей части гистонов в результате многократных солевых экстракций. Специфическая локализация этого фермента в хромосомах очень показательна в свете обсуждавшихся выше петельно-доменных особенностей организации хроматина в ядрах. Создается впечатление, что ДНК-топоизомераза II находится в виде гомодимера в основании петель, взаимодействуя с MAR/SAR-последовательностями ДНК хроматина. Хотя топоизомераза II не обнаруживает строгой специфичности в отношении расщепляемых последовательностей нуклеотидов, на выбор сайтов большое влияние оказывают структурные компоненты хроматина. Показано, что in vivo существуют два класса сайтов, по которым происходит расщепление ДНК этим ферментом: одни из них локализованы в активно транскрибируемых участках хроматина, гиперчувствительных к действию нуклеаз, а другие – непосредственно в MAR/SAR-последовательностях. Ассоциация ДНК-топоизомеразы II с активно транскрибируемыми участками хроматина указывает на ее возможную важную роль в регуляции экспрессии генов, что и было продемонстрировано в недавних экспериментах. Таким образом, ДНК-топоизомераза II является одним из ключевых ферментов, необходимых для разрешения сложных топологических проблем, возникающих при изменении структуры хроматина в процессах репликации ДНК, транскрипции генов и сегрегации хромосом в митозе и мейозе. Определенные изоформы ( или ) этого фермента, по-видимому, играют важную роль в поддержании динамической структуры хроматина интерфазных и митотических хромосом.

Имеющиеся в настоящее время данные свидетельствуют о высокоупорядоченной организации генома у любого, особенно эукариотического, организма. Первым уровнем такой упорядоченности является консервативное линейное распределение генов и других последовательностей нуклеотидов вдоль молекул ДНК хромосом, которое служит важным таксономическим признаком. Другим не менее жизненно важным свойством генома эукариот и, по-видимому, таксономическим признаком является его упорядоченное распределение в объеме интерфазных ядер. Высокоспецифическое пространственное распределение хроматина эукариот в интерфазных ядрах можно рассматривать в качестве второго уровня его упорядоченности. Находясь в деконденсированном состоянии после завершения митоза, интерфазные хромосомы не перемешиваются внутри интерфазных ядер, но занимают вполне определенные микрокомпартменты. Определенные участки хромосом, маркированные специфическими (в частности MAR/SAR) последовательностями, служат для прикрепления ДНК хромосом к компонентам ядерного матрикса и ядерных мембран. Такие контакты необходимы для эффективной реализации генетической информации в процессе экспрессии генов, эффективной конденсации хроматина и разделения хромосом в митозе и мейозе. Кроме того, пространственно организованное распределение генетического материала в интерфазных ядрах обеспечивает дифференциальную защиту от мутаций отдельных генетических локусов и, по-видимому, может контролировать темп и направление эволюционных изменений как отдельных локусов, так и организмов в целом (подробнее см. раздел 5.3). К сожалению, исследование пространственной организации генома в интерфазных ядрах (архитектоники ядра) сопряжено с большими методическими трудностями и сегодня еще только начинается.


  1.  РЕАЛИЗАЦИЯ ГЕНЕТИЧЕСКОЙ ИНФОРМАЦИИ ПРИ ЭКСПРЕССИИ ГЕНОВ

Конечным результатом экспрессии генов, кодирующих белки или нуклеиновые кислоты, должно быть образование этих полноценных в функциональном отношении макромолекул, сопровождаемое формированием определенного фенотипа организма. В соответствии с основным постулатом молекулярной биологии генетическая информация в процессе ее реализации передается однонаправленно от нуклеиновых кислот к белкам. При этом реализуется следующая обобщенная схема: ДНК  РНК  белок, которая подчеркивает, что в ряде специальных случаев возможна передача генетической информации от РНК к ДНК с использованием механизма обратной транскрипции. До сих пор не обнаружена передача генетической информации от белков к нуклеиновым кислотам. На первом этапе экспрессии генов происходит переписывание генетической информации, заключенной в генах, на матричные (информационные) РНК (мРНК – messenger RNA, mRNA), которые являются местом промежуточного хранения этой информации при ее реализации. В некоторых случаях уже сами РНК являются конечным результатом экспрессии генов, и после ряда ферментативных модификаций они непосредственно используются в клеточных процессах. Это относится, прежде всего, к рибосомным и транспортным РНК (рРНК и тРНК), которые вместе составляют основную часть суммарной РНК клетки. К таким РНК принадлежат и малые ядерные РНК (мяРНК), участвующие в процессинге предшественников мРНК эукариот, РНК, входящие в состав ферментов, и природные антисмысловые РНК.

Синтез РНК происходит в результате сложной последовательности биохимических реакций, называемой транскрипцией. Появление русифицированного термина "мРНК" связано с тем, что на втором этапе реализации генетической информации, называемом трансляцией, последовательность нуклеотидов мРНК согласно генетическому коду однозначно определяет последовательность аминокислотных остатков синтезируемых белков, т.е. является матрицей, в соответствии с последовательностями нуклеотидов которой происходит соединение аминокислотных остатков друг с другом в полипептидных цепях белков во время их биосинтеза. Таким образом, экспрессию генов определяют два глобальных молекулярно-генетических механизма: транскрипция генов и трансляция синтезированных мРНК рибосомами, которая завершается образованием полипептидных цепей, кодируемых генами. Однако процесс экспрессии генов не ограничивается их транскрипцией и трансляцией. Существенными моментами экспрессии генов являются посттранскрипционные и посттрансляционные модификации мРНК и белков, которые включают процессинг их предшественников (удаление избыточных последовательностей и другие ковалентные модификации последовательностей РНК и белков). Посттранскрипционные модификации предшественников мРНК обеспечивают подготовку мРНК к эффективной трансляции рибосомами и определяют продолжительность ее существования в цитоплазме. Посттрансляционные модификации белков также необходимы для их полноценного функционирования.

  1.  Транскрипция

В процессе транскрипции генов происходит биосинтез молекул РНК, комплементарных одной из цепей матричной ДНК, сопровождаемый полимеризацией четырех рибонуклеозидтрифосфатов (ATP, GTP, CTP и UTP) с образованием 3'–5'-фосфодиэфирных связей и освобождением неорганического пирофосфата. Основными ферментами, осуществляющими транскрипцию, являются ДНК-зависимые РНК-полимеразы, которые функционируют с участием многочисленных факторов транскрипции – регуляторных белков, осуществляющих высокоспецифические белок–белковые и белково–нуклеиновые взаимодействия. Взаимодействия факторов транскрипции с регуляторными нуклеотидными последовательностями генов, друг с другом и с молекулами РНК-полимеразы необходимы для правильного узнавания транскрипционным комплексом регуляторных последовательностей в составе генов и приводят к повышению или понижению уровня транскрипции соответствующих последовательностей как ответ клеток на внешние или внутренние регуляторные сигналы. Благодаря факторам транскрипции и регуляторным последовательностям генов становится возможным специфический синтез РНК и осуществляется регуляция экспрессии генов на уровне транскрипции.

  1.  ДНК-зависимые РНК-полимеразы

В соответствии с субъединичным составом РНК-полимеразы подразделяются на две группы. К первой группе относятся ферменты, состоящие только из одной субъединицы, среди них – РНК-полимеразы митохондрий и небольших бактериофагов, например SP6 и T7. Эти РНК-полимеразы транскрибируют небольшое число генов простых геномов, и для их функционирования не требуется сложных регуляторных воздействий. Вторую группу составляют сложно устроенные РНК-полимеразы бактерий и эукариот, которые представляют собой многосубъединичные белковые комплексы, транскрибирующие сотни и тысячи различных генов. Такие ферменты во время своего функционирования реагируют на многочисленные регуляторные сигналы, поступающие от регуляторных последовательностей нуклеотидов и белковых факторов. Не исключено, что общепринятое разделение РНК-полимераз по структурно-функциональному признаку является упрощением. Имеются данные, указывающие на то, что и просто устроенные фаговые РНК-полимеразы функционируют in vivo в комплексе с другими белками бактериальных клеток, которые могут существенно изменять их ферментативные свойства.

РНК-полимераза E. coli. Наиболее изученной из бактериальных ферментов является РНК-полимераза E. coli. Она осуществляет транскрипцию всех бактериальных генов. Фермент состоит из пяти субъединиц: ‘- (молекулярная масса 165 кДа), - (155 кДа), двух - (35 кДа каждая) и - (чаще всего 70 кДа (70)). Комплекс из четырех субъединиц , часто обозначаемый буквой Е (enzyme), образует так называемый минимальный (кор-) фермент E. coli, который способен осуществлять все основные этапы транскрипции, за исключением правильной инициации (см. ниже). Для инициации транскрипции требуется присутствие определенной регуляторной -субъединицы, необходимой для распознавания РНК-полимеразой промоторов бактериальных генов, определяющей специфичность взаимодействия РНК-полимеразы с промоторами и, возможно, последующую изомеризацию комплекса РНК-полимераза–промотор, необходимую для начала синтеза РНК. Полный фермент, включающий 70-субъединицу, часто называют холоферментом и обозначают Е70. РНК-полимераза Е70 способна транскрибировать большинство (но не все) генов E. coli. В частности, для транскрипции генов теплового шока, оперонов gln или nif требуется включение в состав полного фермента другой регуляторной субъединицы – 54 (молекулярная масса 54 кДа) вместо 70 с образованием фермента E54. В настоящее время описано до десяти различных -факторов, объединение которых с минимальным ферментом дает возможность образующимся холоферментам узнавать разные промоторы. Все четыре субъединицы кор-фермента обеспечивают контакт РНК-полимеразы с промоторами. При этом ‘-субъединица участвует в связывании фермента с ДНК, -субъединица образует каталитический активный центр, а -субъединицы обеспечивают правильное взаимодействие фермента с промоторами. Утверждения, заключенные в двух последних предложениях, нужно воспринимать с известной долей скепсиса. Данные такого рода обычно получают с использованием ферментов, у которых под действием мутаций изменены конкретные субъединицы, и если, например, мутация в гене -субъединицы нарушает связывание РНК-полимеразы с ДНК, делаются соответствующие выводы. Такая методология (впрочем, одна из самых плодотворных среди существующих), к сожалению, напоминает известный способ локализации органа слуха у тараканов путем обрывания ног – поскольку тараканы без ног не реагируют на звуки убеганием, делается вывод, что они воспринимают звуковые сигналы ногами. Любая мутантная субъединица в составе олигомерного фермента может изменять его общую конформацию и придавать ферменту самые неожиданные свойства. Более прямым методом определения мест контакта макромолекул при белок–белковых и белково–нуклеиновых взаимодействиях является метод поперечных сшивок с использованием бифункциональных химических агентов. Такие химические соединения образуют ковалентные связи (поперечные сшивки) между близкорасположенными реакционноспособными группами. Однако сам факт наличия контакта между макромолекулами еще нельзя однозначно интерпретировать в пользу его функциональной значимости.

В отличие от эубактерий, которые, как уже упоминалось выше, при транскрипции различных наборов генов используют разные -факторы, эукариоты для достижения тех же целей прибегают к другой стратегии – специализации молекул РНК-полимераз. В ядрах эукариот обнаружены по меньшей мере три специализированные формы РНК-полимераз. РНК-полимераза I осуществляет транскрипцию генов рибосомных РНК (рРНК), синтезируя в ядрышках предшественники 18S и 28S рРНК; РНК-полимераза II участвует в образовании мРНК, а РНК-полимераза III транскрибирует гены транспортных (тРНК), 5S и других низкомолекулярных РНК. Каждый из этих ферментов представляет собой многосубъединичный белковый комплекс, состоящий из двух больших (120–220 кДа) и 5–13 малых (10–100 кДа) субъединиц. Несколько малых субъединиц являются общими для разных форм РНК-полимераз. Большие же субъединицы гомологичны своими аминокислотными последовательностями участкам - и -субъединиц эубактерий, что, возможно, отражает фундаментальное сходство в структуре и функционировании активных центров этих ферментов. Более того, аминокислотные последовательности -субъединиц бактериальных РНК-полимераз, необходимые для их взаимодействия с большими субъединицами минимального фермента, имеют гомологи в третьей по размеру большой субъединице РНК-полимеразы II, а также в субъединице, общей у РНК-полимераз I и III. Несколько небольших субъединиц эукариотических РНК-полимераз, не имеющих аналогов у бактериальных ферментов, являются общими для всех РНК-полимераз, что может указывать на их одинаковые функции в транскрипции, осуществляемой соответствующими ферментами, и на их возможное участие в координации функционирования разных РНК-полимераз.

РНК-полимераза I эукариот (Pol I). Как и большинство других высокомолекулярных полипептидов, большие субъединицы РНК-полимераз содержат хорошо различимые структурные и функциональные домены: дискретные участки полипептидных цепей, несущие конкретную функциональную нагрузку. Клонирование генов соответствующих субъединиц и определение их первичной структуры позволили выявить эволюционно консервативные участки полипептидных цепей и провести мутационный анализ функциональной значимости их отдельных доменов. Для этой цели в полипептидных цепях с помощью направленного мутагенеза заменяли соответствующие аминокислоты и мутантные субъединицы использовали в сборке ферментов из отдельных субъединиц in vitro с последующим анализом свойств таких реконструированных ферментов. На рис. I.4,а суммированы данные, полученные для двух самых больших субъединиц (RPA194 и  RPA116) Pol I мышей, которые являются функциональными аналогами β'- и β-субъединиц РНК-полимеразы E. coli.

РНК-полимераза I эукариот является большим ферментом, построенным по меньшей мере из 11 субъединиц. Минимальный фермент Pol I содержит два обсуждавшихся выше больших полипептида с молекулярной массой 194 и 116 кДа, которые ассоциированы с несколькими малыми субъединицами (от трех до 14 в зависимости от метода очистки), молекулярные массы которых лежат  в пределах 15–60 кДа. Третья по величине субъединица Pol I мышей с молекулярной массой 53 кДа, названная PAF53 (polymerase associated factor 53), играет важную роль в узнавании Pol I своих промоторов и, по-видимому, является структурным и функциональным аналогом белка RPA49 дрожжей. Pol I дрожжей в отсутствие субъединиц RPA49 и RPA35.5 (так называемая Pol I*) эффективно транскрибирует при низких концентрациях солей искусственную матрицу poly[d(A-T)], но не нативную двухцепочечную ДНК. Полагают, что эти субъединицы необходимы для эффективного образования инициационных комплексов (см. ниже).

Используя антитела к отдельным субъединицам Pol I и последующую иммунопреципитацию, установили, что в клетке, по крайней мере, часть Pol I находится в составе больших комплексов, с которыми ассоциированы факторы транскрипции. Пять компонентов такого холофермента Pol I изучены в настоящее время наиболее детально.

Мышиный фактор TIF-IB (Pol I-specific transcription initiation factor B), известный также, как фактор D, обеспечивает Pol I селективность в отношении промоторов генов рРНК (рДНК). Аналогичный белок у человека назван hSL1, у крыс – rSL1 и у X. laevis – Rib 1. Взаимодействие фактора TIF-IB/SL1 с промотором рДНК обеспечивает связь холофермента Pol I с промотором и сборку прединициационного комплекса. Фактор TIF-IB/SL1 состоит из четырех субъединиц, одна из которых является основным фактором транскрипции TBP, необходимым для функционирования РНК-полимераз всех трех классов. (Подробнее об основных факторах транскрипции см. следующий раздел 2.1.3.) Три других субъединицы с молекулярными массами 110, 63 и 48 кДа представляют собой разные TBP-ассоциированные факторы TAFI, индивидуально и специфически взаимодействующие с TBP, а также друг с другом, образуя прочный комплекс. В составе комплекса TAFI48 обеспечивает контакт TIF-IB/SL1 с фактором UBF (см. ниже), а TAFI63 и TAFI110 участвуют в распознавании промотора. Факторы TAFI не обнаруживают гомологии с соответствующими факторами TAFII, специфичными в отношении Pol II. Более того, первый из связавшихся с TBP факторов TAFI предотвращает взаимодействие с TBP факторов TAFII (и наоборот), что делает невозможным образование непродуктивных химерных комплексов. Одновременно взаимодействие TAFI48 с TBP изменяет ДНК-связывающие свойства последнего, после чего тот перестает узнавать TATA-бокс – характерный структурный элемент Pol II-промоторов, и, следовательно, теряет способность обеспечивать инициацию транскрипции Pol II.

Другой белок, входящий в состав холофермента Pol I, UBF (upstream binding factor) высоко консервативен у разных видов животных. UBF является членом семейства факторов транскрипции, содержащих ДНК-связывающий HMG-домен (high mobility group domain) – основную последовательность из 80 аминокислот. С помощью ЯМР-спектроскопии установлено, что полипептидная цепь HMG-домена организована в три α-спирали, расположенные в виде буквы L, которые формируют три ДНК-связывающих поверхности с внешней стороны L. В клетке UBF присутствуют в двух формах – UBF1 и UBF2 с молекулярными массами 97 и 95 кДа, которые образуются в результате альтернативного сплайсинга. UBF1 содержит пять HMG-доменов, фланкированных N-концевым димеризующим мотивом и короткой кислой C-концевой последовательностью. Интересно, что соседние HMG-домены одного и того же UBF обладают гораздо меньшей гомологией, чем соответствующие домены UBF разных видов (например шпорцевой лягушки и человека). Полагают, что каждый HMG-домен обеспечивает особую, эволюционно консервативную функцию молекулы UBF. Такими функциями могут быть распознавание специфических последовательностей ДНК, создание молекулярных интерфейсов для белок–белковых взаимодействий между Pol I и TIF-IB/SL1, а также различными репрессорами и активаторами транскрипции рДНК. С-Концевая последовательность UBF содержит несколько фосфорилируемых остатков Ser и необходима для активации транскрипции рДНК. Одной из основных характеристик белков, содержащих HMG-бокс, является их способность изгибать молекулу ДНК и прочно связываться с ее крестообразными структурами. Всеми этими свойствами обладает UBF, и они детально исследованы.

Белок CPBF (core promoter binding factor), выделенный из асцитных клеток аденокарциномы молочных желез крыс, специфически взаимодействует с коровым участком промотора рДНК (о структуре промотора см. в разделе 2.1.2.). CPBF, прочно взаимодействующий с Pol I, состоит из двух субъединиц USF1 и USF2 с молекулярными массами 44 и 39 кДа соответственно. Гомодимеры USF1 и USF2 являются сильными ингибиторами транскрипции Pol I, тогда как гетеродимеры USF1/USF2 стимулируют транскрипцию in vitro. Полагают, что CPBF участвует в регуляции транскрипции Pol I in vivo.

TIF-IA – другой компонент холофермента Pol I, также участвует в регуляции синтеза рРНК этим ферментом. В его отсутствие инициационный комплекс не может образовывать первой фосфодиэфирной связи, а следовательно, и инициировать синтез РНК. TIF-IA освобождается после инициации транскрипции и может вновь входить в состав собирающихся прединициационных комплексов. По этим и ряду других критериев TIF-IA рассматривают в качестве функционального аналога бактериального фактора σ70. TIF-IA является мономерным глобулярным белком с молекулярной массой 70–80 кДа. Активность этого фактора или его внутриклеточное содержание уменьшается при подавлении синтеза белка, истощении сыворотки или дифференцировке клеток и возрастает в ответ на митогенные стимулы, что коррелирует с подавлением или стимуляцией синтеза рРНК.

Хроматографически и с помощью иммунопреципитации было установлено, что жизненно важный фактор TIF-IC в растворе ассоциирован с Pol I. Этот фактор необходим как для сборки инициационных комплексов, так и образования первой фосфодиэфирной связи. Его присутствие предотвращает неспецифическую инициацию транскрипции и ее преждевременную терминацию, что проявляется в образовании гомогенных транскриптов правильной длины. По этим критериям фактор TIF-IC рассматривают в качестве функционального аналога TFIIF (RAP30/74) Pol II (см. ниже).

РНК-полимераза II (Pol II). Pol II человека содержит более 10 субъединиц, которые трудно назвать субъединицами в обычном смысле из-за слабой ассоциации друг с другом. Некоторые из них принадлежат к основным факторам транскрипции (GTFs – general transcription factors). Вообще же понятие холофермента Pol II эукариот не является устоявшимся. Лишь недавно в лабораториях Р.Янга и Р.Корнберга было установлено, что некоторые основные факторы транскрипции уже находятся в комплексе с РНК-полимеразой до ее включения в прединициационный комплекс. По мнению Янга, которое становится все более обоснованным, в состав холофермента Pol II дрожжей входят по меньшей мере 14 белков и белковых комплексов, перечисленных в табл. I.3.

 

Таблица I.3

Характеристики белковых компонентов холофермента

РНК-полимеразы II дрожжей

Компонент

Характеристика

Pol II

РНК-Полимеразная активность, взаимодействует с множеством общих и тканеспецифических факторов транскрипции, участвует в выборе точки инициации транскрипции

TFIIB

Связывает Pol II и TBP на промоторе, участвует в выборе точки инициации транскрипции

TFIIF

Взаимодействует с Pol II, стимулирует элонгацию транскрипции Pol II, компонент субкомплекса SRB/медиатор

TFIIH

Активность ДНК-зависимой ATPазы, ДНК-хеликазная активность, обладает активностью CTD-киназы

SRB2, SRB5

Участвуют в образовании инициационного комплекса, стимулируют базальный и индуцированный синтез РНК, взаимодействуют с TBP, компоненты субкомплекса SRB/медиатор

GAL11/SPT13

Участвуют в образовании инициационного комплекса, стимулируют базальный и индуцированный синтез РНК, компоненты субкомплекса SRB/медиатор, предположительно взаимодействуют с активаторами транскрипции

SUG1

Компонент субкомплекса SRB/медиатор, предположительно взаимодействует с активаторами транскрипции

SRB4, SRB6, SRB7, SRB8, SRB9, SRB10, SRB11

Компоненты субкомплекса SRB/медиатор, предположительно взаимодействуют с CTD-доменом Pol II

 

Среди факторов, которые отличаются от основных факторов транскрипции, но играют особую роль в транскрипции у дрожжей, следует отметить так называемые SRB-белки (suppressor of RNA polymerase B). Последние являются неотъемлемой частью холофермента Pol II и относятся к коактиваторам транскрипции. SRB-Белки идентифицированы с помощью генетических методов при отборе мутаций у дрожжей, которые супрессировали условно-летальные мутации в CTD-домене Pol II (С-концевом домене большой субъединицы РНК-полимеразы II). Такой генетический скрининг привел к открытию девяти генов SRB. С помощью тех же мутантов установлено, что SRB-белки необходимы для осуществления инициации транскрипции РНК-полимеразой in vivo. Вскоре было подтверждено физическое и функциональное взаимодействие между SRB-белками и CTD-доменом Pol II, которые, как оказалось, образуют с РНК-полимеразой прочный комплекс.

Транскрипция с участием холофермента Pol II стимулируется активатором GAL4–VP16, что не происходит в присутствии только одних очищенных основных факторов транскрипции и Pol II. На этом основании был сделан вывод, что истинный холофермент Pol II содержит дополнительные компоненты, которые позволяют ему реагировать на действие белков-активаторов транскрипции. Более того, показано, что антитела к CTD-домену вызывают диссоциацию многосубъединичного комплекса, содержащего Pol II, SRB-белки, TFIIF, GAL11/SPT13, SUG1 и еще 10 белков, часть из которых относится к классу белков-коактиваторов транскрипции. Этот комплекс белков получил название медиаторного комплекса. Он оказался необходимым для осуществления функциональной связи между Pol II и белками-активаторами транскрипции (подробнее о коактиваторах транскрипции см. раздел 3.2.2).

Субъединичное строение РНК-полимераз разного происхождения, вероятно, отражает их функциональную роль в акте транскрипции. Действительно, все РНК-полимеразы простого строения транскрибируют узкоограниченный круг генов или небольшие части генома, что имеет место, например при синтезе РНК-затравок для фрагментов Оказаки в процессе репликации ДНК у бактерий. Промоторы, узнаваемые РНК-полимеразами простого строения, не отличаются разнообразием и обладают простой структурой. Показательно, что при сложном строении генома четных T-фагов, в процессе развития которых происходит многократное переключение транскрипции с одних групп генов на другие, используется сложная РНК-полимераза бактерии-хозяина, а не индуцируется простой фермент, как это имеет место у бактериофага T7.

РНК-полимеразы бактерий и эукариот должны, во-первых, узнавать разные промоторы, во-вторых, реагировать на различные белки-регуляторы и, в-третьих, изменять специфичность узнавания последовательностей нуклеотидов матричных ДНК под действием разнообразных белковых эффекторов. Отсюда следует, что у живых организмов, начиная с бактерий, возникает потребность в РНК-полимеразах сложной структуры, способных осуществлять обширную программу реализации генетической информации. Вероятно, поэтому наблюдается иерархия в степени сложности строения указанных ферментов, которая достигает верхнего предела в случае РНК-полимераз эукариот.

Тем не менее, элементарные акты основных этапов транскрипции (см. ниже) обеспечиваются молекулами РНК-полимераз простого строения, такими как у фагов T7, митохондрий и других объектов. Эти ферменты, по мнению Р.Б. Хесина, можно рассматривать в качестве эволюционных предшественников сложных олигомерных РНК-полимераз, способных самостоятельно осуществлять все основные функции в процессе транскрипции. Действительно, у олигомерных РНК-полимераз, как и у большинства сложноустроенных ферментов, по-видимому, только одна субъединица ( – у РНК полимераз эубактерий) является собственно каталитической, а остальные, возможно, выполняют функции регуляторных.

  1.  Единицы транскрипции (транскриптоны)

Синтез РНК молекулами РНК-полимераз in vivo начинается в определенных местах ДНК, называемых промоторами, и завершается на особых регуляторных последовательностях – терминаторах. Последовательности нуклеотидов ДНК, заключенные между промоторами и терминаторами, называют транскрипционными единицами, или транскриптонами. В пределах каждого транскриптона транскрибируется только одна цепь ДНК, которая получила название значащей или матричной. Термины "транскрипционная единица" или "транскриптон" по смыслу близки термину "ген", но они не всегда совпадают. Так, транскрипционные единицы прокариот, как правило, заключают в себе генетическую информацию нескольких генов и называются оперонами. Продуктами транскрипции оперонов являются полицистронные мРНК, в результате трансляции которых рибосомами образуется несколько белков. Белки, кодируемые полицистронными мРНК, обычно функционально связаны друг с другом и обеспечивают протекание какого-либо метаболического процесса, например биосинтеза определенной аминокислоты или утилизацию углеводов в качестве источника углерода. Организация генов в виде оперонов облегчает координированную регуляцию их экспрессии на уровне транскрипции. Согласованная регуляция транскрипции (и других этапов экспрессии) многих генов, не образующих одного оперона, чаще всего осуществляется специфическими белками-регуляторами, которые взаимодействуют с гомологичными регуляторными нуклеотидными последовательностями, маркирующими гены данной группы.

Промоторы эубактерий. В 1964 г. Ф. Жакобом, А. Уллманом и Ж. Моно была впервые сформулирована концепция промотора как особого регуляторного элемента в составе lac-оперона E. coli. Вскоре после этого были описаны промоторные мутации и высказано предположение, что промоторные участки оперона должны распознаваться молекулами РНК-полимеразы, а также заключать в себе сайт инициации транскрипции. В соответствии с генетическими критериями промотором может называться последовательность нуклеотидов, мутации в которой характеризуются следующими свойствами: 1) оказывают влияние на транскрипцию всех генов оперона; 2) действуют в цис-, но не транс-положении по отношению к генам, контролируемым мутантными промоторами; 3) локализуются вблизи одного из концов оперона, однако отличаются от мутаций в структурных частях генов тем, что не оказывают влияния на активность кодируемых этими генами ферментов. В соответствии с биохимическими критериями промотор представляет собой последовательность нуклеотидов, обеспечивающую базальный (но не максимальный) уровень транскрипции соответствующего транскриптона. Он является той минимальной последовательностью, которая специфически распознается холоферментом РНК-полимеразы среди случайных последовательностей нуклеотидов, что обнаруживается по образованию в определенных условиях стабильных комплексов фермент–ДНК.

Структура обобщенного минимального промотора для холофермента РНК-полимеразы (E70) эубактерий схематически представлена на рис. I.4,б. Такие промоторы содержат две канонические последовательности: область 35, обычно расположенную между нуклеотидами в положениях –30 и –35, и область –10, локализованную между нуклеотидами –7 и –10 (знак "минус" указывает на то, что нуклеотиды находятся перед первым транскрибируемым нуклеотидом, которому соответствует положение +1). Обе эти последовательности специфически взаимодействуют с двумя участками полипептидной цепи 70, называемыми 4.2 и 2.4. Расстояние между обсуждаемыми последовательностями оказывает влияние на активность промотора. Длина отрезка в 17 п.о. является оптимальной. Среди других последовательностей, оказывающих влияние на активность промоторов, но не являющихся универсальными, следует упомянуть так называемый UP-элемент – АТ-богатую последовательность, центр которой находится в положении –52 у промотора P1 гена rrnB, кодирующего рРНК. С этим участком взаимодействует -субъединица РНК-полимеразы. У нескольких других промоторов был обнаружен TG-элемент (центр – в положении –15 или –14), мутации в котором снижают активность этих промоторов.

Влияние мутаций в областях –10 и –35 на активность промотора, как правило, хорошо коррелирует с тем, насколько новая мутантная последовательность соответствует канонической. Однако в ряде случаев наблюдаются отклонения от этого правила, что позволило идентифицировать последовательности, важные для функционирования этих промоторов in vivo, с центрами в положениях –43 (область USR – upstream region), а также между нуклеотидами в положениях –1 и +20 (область DSR – downstream region). Эти последовательности не требуются для узнавания промотора РНК-полимеразой, однако облегчают процесс освобождения промотора после инициации транскрипции (см. ниже). Все описанные последовательности обеспечивают базальный уровень функционирования бактериальных промоторов. Однако активность промоторов может изменяться под действием многочисленных регуляторных факторов, взаимодействующих с другими регуляторными последовательностями, расположенными перед такими промоторами. Эти аспекты регуляции активности промоторов будут подробно рассмотрены в разделе 3.1.

Промоторы эукариот. Промоторы эубактерий были определены выше как минимальный набор последовательностей нуклеотидов, необходимых для их специфического распознавания холоферментом РНК-полимеразы и начала (инициации) синтеза РНК. Распространение этого определения на промоторы эукариот встречает трудности из-за невозможности в настоящее время исчерпывающе описать эукариотический функциональный аналог бактериального холофермента E.

Промоторы РНК-полимеразы II. Промоторы, узнаваемые РНК-полимеразой II, содержат три различных семейства регуляторных последовательностей ДНК. Последовательности первого семейства включают так называемые кóровые, или базальные элементы промотора, расположенные вблизи точки инициации транскрипции (см. рис. I.4,б). В настоящее время известны два класса базальных элементов: TATA-последовательность, расположенная за 25–30 нуклеотидов до точки инициации (каноническая последовательность – TATAa/tAa/t), и так называемый инициатор (Inr), последовательность которого обогащена пиримидинами (каноническая последовательность – PyPyA+1NT/APyPy). В этих обозначениях строчные буквы соответствуют нуклеотидам, которые присутствуют не во всех последовательностях, Py – пиримидиновые нуклеотиды инициатора, N – любой нуклеотид. Подстрочная цифра указывает на то, что с данного нуклеотида начинается транскрипция (точка инициации транскрипции). Элементы TATA-последовательности и инициатор необходимы для сборки ДНК-белкового инициационного комплекса и распознаются основными факторами транскрипции. Промоторы РНК-полимеразы II содержат один или оба регуляторных элемента или же не имеют их вообще. При этом оба элемента могут функционировать независимо друг от друга или же в их действии наблюдается синергизм.

К двум другим классам цис-регуляторных промоторных элементов у эукариот относятся последовательности, расположенные вблизи промотора (от 50 до нескольких сотен пар оснований перед точкой инициации), а также дистальные элементы (энхансеры и сайленсеры), расстояние которых от промотора может превышать 60 т.п.о. Оба класса таких последовательностей содержат сайты связывания регуляторных белков, модулирующих транскрипцию.

Обобщенная схема промотора РНК-полимеразы II в составе инициационного комплекса представлена на рис. I.5. На ней отображены многочисленные белок–белковые и белково–нуклеиновые взаимодействия при инициации транскрипции. На этой схеме также указано наличие во многих промоторах консервативной последовательности CA, которая находится непосредственно перед нуклеотидом А+1. У некоторых промоторов, в частности ассоциированных с генами домашнего хозяйства, может отсутствовать явно выраженная TATA-последовательность. Проксимальные и дистальные регуляторные элементы промоторов построены из коротких транскрипционных элементов длиной в 10–15 п.о., с которыми непосредственно взаимодействуют факторы транскрипции. Проксимальные регуляторные элементы, как правило, имеют простую структуру, включающую один или несколько транскрипционных элементов (ТЭ). В то же время энхансеры устроены более сложно. Следует заметить, что в активном промоторе дистальные и проксимальные регуляторные элементы сближены друг с другом, в результате чего происходит "выпетливание" разделяющих их протяженных последовательностей ДНК.

Промоторы РНК-полимеразы III. Как уже упоминалось выше, гены, транскрибируемые РНК-полимеразой III, можно разделить на три основных класса (см. рис. I.4,б). К 1-му классу относят гены 5S рРНК, которые содержат внутреннюю регуляторную область (internal control region – ICR). Три элемента ICR, с которыми взаимодействует основной фактор транскрипции TFIIIA, локализованы между нуклеотидами +50 и +64. Комплекс TFIIIA–ICR стабилизируется после взаимодействия с TFIIIA фактора TFIIIC, хотя для последнего в промоторе отсутствует специфический участок связывания (подробнее о факторах транскрипции см. в разделах 2.1.3 и 3.2). Мутации, локализованные в окрестностях точки инициации транскрипции промоторов классов 1 и 2, оказывают сильное влияние на транскрипцию этих генов, что указывает на возможное присутствие в этих промоторах дополнительных регуляторных элементов.

Гены тРНК относят ко второму классу. Для промоторов этих генов характерно наличие внутренних блоков регуляторных последовательностей A и B. Блок А локализован между нуклеотидами +10 и +20, тогда как блок B удален от него на расстояние 30–60 п.о. по направлению к 3’-концу гена. Эти регуляторные элементы узнаются непосредственно фактором TFIIIC, который образует с ними очень прочный комплекс. По крайней мере, четыре полипептидные цепи, входящие в состав комплекса TFIIIC–промотор, контактируют друг с другом и покрывают участок ДНК между положениями –25 и +75. Канонический регуляторный элемент в окрестностях точки инициации транскрипции был локализован путем анализа последовательностей нуклеотидов в соответствующих генах тРНК.

Гены третьего класса кодируют малые ядерные РНК, например U6-РНК у высших эукариот, и содержат только регуляторные элементы, расположенные перед точкой инициации транскрипции. У большинства генов этого класса регуляторные элементы состоят из ТАТА-последовательности с центром в положении –30 и из проксимального элемента PSE (proximal sequence element) с центром в положении –60. Несмотря на наличие ТАТА-элемента, обычно определяющего положение точки инициации транскрипции, в данном случае именно PSE фиксирует положение этой точки. Аналогичную функцию у промоторов РНК-полимеразы II выполняет ТАТА-последовательность. Состав белковых компонентов, образующих комплекс с PSE, в настоящее время до конца не выяснен. Обнаружены два различных PSE-связывающих белковых комплекса, названные SNAP и PTF. Активность промоторов третьего класса зависит от наличия ТАТА-связывающего белка (TBP). Белок ТВР, входящий в состав фактора транскрипции TFIIIB, взаимодействует непосредственно с ТАТА-элементом промотора. Поскольку для инициации транскрипции на этих промоторах требуется наличие PSE-элемента, предполагают, что PSE-связывающий фактор взаимодействует с ТВР-компонентом фактора TFIIIB. Интересно, что промотор гена U6-РНК животных, узнаваемый РНК-полимеразой III, отличается от промотора гена U2-РНК, с которым взаимодействует РНК-полимераза II, только отсутствием ТАТА-элемента U2-промотора. У растений оба этих промотора содержат такие регуляторные элементы, а изменение расстояния между ТАТА-элементом и расположенным перед ним регуляторным элементом превращает промотор U6 из Pol III-зависимого в Pol II-зависимый. Несмотря на наличие у промоторов этих РНК-полимераз характерных черт, описанных выше, механизмы, по которым РНК-полимеразы II и III различают свои промоторы, остаются невыясненными.

Промоторы РНК-полимеразы I. Несмотря на то, что участки генома, кодирующие рРНК, относятся к одним из наиболее консервативных, регуляторные последовательности, обеспечивающие инициацию транскрипции у разных видов, сильно дивергированы. Одно из объяснений этого явления основывается на факте вхождения рДНК в мультигенное семейство (гены рРНК многократно повторены в геноме). В этой связи мутации в регуляторной области одного гена, которые благоприятно сказываются на его экспрессии, могут быстро распространиться в семействе последовательностей благодаря генной конверсии, неравному кроссинговеру и/или последовательным актам их эксцизии и реинтеграции в геном. В соответствии с этой интерпретацией, промоторные последовательности рДНК обнаруживают мало гомологии даже у таких близких видов, как человек и мышь. Тем не менее, общий план строения промоторов рДНК практически не различается у всех исследованных эукариот. Промоторы РНК-полимеразы I содержат два кόровых регуляторных элемента (CPE – core promoter element), локализованных между положениями –75 и –50, а также –30 и +1 (см. рис. I.4, б). Основной промотор лишь слабо связывает TBP-содержащий белковый комплекс SL1 (у людей и крыс), в состав которого, кроме того, входят еще три видоспецифических фактора транскрипции (TBP associated factor – TAF), специфичных в отношении РНК-полимеразы I. Сборка прединициационного комплекса (см. раздел 2.1.3) в этом случае не зависит от специфического взаимодействия TBP и ДНК, так как промоторы РНК-полимеразы I не содержат TATA-последовательности. Как уже упоминалось выше, TAFI63 и TAFI110, входящие в состав комплекса SL1, являются ДНК-распознающими компонентами комплекса. С помощью футпринтинга (см. раздел 7.6.4) было установлено, что комплекс SL1 остается связанным с промотором на протяжении нескольких раундов инициации синтеза РНК РНК-полимеразой I. Стабильное взаимодействие комплекса SL1 с промотором требует участия дополнительного ДНК-связывающего белка UBF, который сам по себе обладает способностью слабо связываться с удаленной регуляторной последовательностью UCE (upstream control element), расположенной между нуклеотидами в положениях –90 и –150. Синергизм в стимулирующем действии SL1 и UBF на транскрипцию РНК-полимеразой I может быть обусловлен наличием непосредственных контактов между этими двумя факторами. Другим регуляторным элементом, удаленным от точки инициации транскрипции промотора Pol I, является энхансер, построенный из коротких повторяющихся последовательностей.

Последовательность CPE обеспечивает специфичность транскрипции генов рРНК, и ее достаточно для инициации. В этой связи последовательность UCE и энхансер не рассматриваются в настоящее время как части промотора РНК-полимеразы I. Кроме того, соответствующие промоторы простейших, грибов и растений последовательность UCE не содержат, а белок UBF не является необходимым компонентом бесклеточных систем транскрипции. Как будет подробно рассмотрено ниже, образование прединициационного комплекса РНК-полимеразой II требует участия фактора TFIIB. Аналогичный в функциональном отношении белковый фактор BRF также необходим для инициации транскрипции РНК-полимеразой III. Соответствующий белковый компонент РНК-полимеразы I еще не идентифицирован. Помимо фактора, связывающего кóровую последовательность – CPBF, в инициации синтеза рРНК принимает участие фактор, связывающий энхансер 1, – E1BF (enhancer 1-binding factor), который не входит в состав холофермента Pol I. Оба фактора заметно повышают базальный уровень синтеза рРНК в бесклеточных системах транскрипции.

  1.  Этапы транскрипции

Процесс транскрипции в настоящее время принято подразделять на 4 основные стадии: 1) связывание молекул РНК-полимеразы с ДНК и распознавание промотора; 2) инициация; 3) элонгация; 4) терминация. Как будет видно из дальнейшего изложения, три последних этапа характерны для биосинтеза большинства других макромолекул клетки, особенно для тех из них, синтез которых является матричным, в частности белков. После связывания с ДНК молекулы РНК-полимеразы осуществляют поиск промоторов, на которых происходит формирование инициационных комплексов. Начальная стадия инициации транскрипции завершается образованием нескольких первых фосфодиэфирных связей в молекуле вновь синтезируемой РНК, после чего транскрипция переходит в стадию элонгации – последовательного удлинения синтезируемых молекул РНК. Стадия элонгации заканчивается по достижении молекулами РНК-полимераз специальных регуляторных последовательностей ДНК, называемых терминаторами транскрипции, после чего происходит освобождение синтезированных молекул РНК и РНК-полимераз из транскрипционных комплексов. Освободившиеся молекулы РНК-полимераз приобретают способность вступать в новый цикл транскрипции. Следует помнить, что четкое разделение единого процесса транскрипции на отдельные стадии условно; оно используется главным образом для удобства описания механизмов биосинтеза РНК и является упрощенной моделью. Основные этапы транскрипции, а также дальнейшие пути реализации генетической информации схематически представлены на рис. I.6.

В обычных условиях холофермент РНК-полимераз эубактерий для инициации транскрипции не требует дополнительных факторов. В отличие от этого для точной инициации транскрипции РНК-полимеразой II требуется наличие, кроме ее субъединиц, еще и основных факторов транскрипции. Синтез РНК, который не зависит от присутствия регуляторных молекул, получил название базальной транскрипции. Транскрипция в клетках является регулируемым процессом, который, как уже упоминалось выше, требует участия белков-активаторов или репрессоров. Белок-активатор (тканеспецифический фактор транскрипции) взаимодействует с регуляторными последовательностями ДНК и активирует синтез РНК. Такая транскрипция получила название индуцированной, или активированной. Следовательно, базальная транскрипция не может происходить in vivo, и этот термин используется только при описании результатов исследований синтеза РНК in vitro, в бесклеточных системах транскрипции.

Связывание молекул РНК-полимеразы с ДНК и поиск промоторов. Механизм поиска промоторов на ДНК молекулами РНК-полимеразы в настоящее время до конца не выяснен. Принято считать, что после первоначального непрочного связывания с ДНК в случайных местах молекулы РНК-полимеразы перемещаются вдоль двойной спирали ДНК до тех пор, пока не обнаруживают последовательности нуклеотидов промоторов, на которых взаимодействие фермента с ДНК становится более прочным. Во время движения молекулы РНК-полимеразы могут периодически отделяться от ДНК и связываться с ней на новом месте, что ускоряет процесс поиска промоторов. Как уже упоминалось выше, в связывании с ДНК участвует -субъединица РНК-полимеразы E. coli, а - и особенно -субъединицы необходимы для специфического распознавания промоторов. Установлено, что холофермент РНК-полимеразы E. coli (минимальный фермент, содержащий -субъединицу) закрывает в области промотора участок ДНК длиной ~50 п.о. При этом -субъединицы контактируют с ДНК в области   35-го нуклеотида промотора.

Инициация транскрипции. Инициация транскрипции начинается со сборки на промоторе прединициационного комплекса, в состав которого входят молекулы РНК-полимеразы и матричной ДНК. Если в случае РНК-полимеразы E. coli и других прокариот для осуществления этого процесса нет необходимости в присутствии других белковых факторов, то механизм сборки инициационного комплекса с участием РНК-полимеразы II носит более сложный характер. В настоящее время существуют две модели инициации транскрипции РНК-полимеразой II. В соответствии с одной из них на промоторе происходит постепенная (ступенчатая) сборка инициационного комплекса из отдельных компонентов. Другая модель акцентирует внимание на то, что Pol II может входить в состав инициационного комплекса в виде холофермента, состоящего из многих субъединиц. Хотя вторая модель становится доминирующей, ниже будет подробнее рассмотрена первая модель, более наглядно описывающая процесс инициации транскрипции у эукариот.

Сборка такого комплекса начинается с последовательного связывания с промотором основных факторов транскрипции (табл. I.4). Обычно факторами транскрипции называют белки или белковые комплексы, непосредственно не участвующие в каталитическом акте образования РНК, но необходимые для прохождения основных этапов транскрипции и ее регуляции. По функциональному признаку принято различать три класса факторов транскрипции. К первому классу относятся основные факторы транскрипции, обеспечивающие нерегулируемый базальный уровень транскрипции и функционирующие в клетках всех типов.

 

Таблица I.4

Субъединичный состав и характеристика основных факторов транскрипции (GTF) РНК-полимеразы II человека

Фактор

(GTF)

Молекулярные массы субъединиц (кДа) и их обозначение

Характеристика

TFIIA

37 ()

19 ()

13 ()

Требуются для активации транскрипции, стабилизируют взаимодействие TBP с TATA-боксом, а также TAF с ДНК, необходимы для активации некоторых промоторов

TFIIB

35

Стабилизирует комплекс Pol II/TFIIF на промоторе, обеспечивает выбор точки инициации транскрипции, претерпевает конформационные изменения под действием белков-активаторов

TFIID

38 (TBP)

250 (TAFII250)

150 (TAFII150)

135 (TAFII135)

95 (TAFII95)

80 (TAFII80)

55 (TAFII55)

31 (TAFII31)

28 (TAFII28)

20 (TAFII20)

Узнает ТАТА-последовательность, является мишенью для белков-трансактиваторов транскрипции

Сериновая протеинкиназа, узнает HMG-бокс

Узнает 3’-концевые области промотора

Гомолог гистона H4

Гомолог гистона H3

Гомолог гистона H2B


Таблица 1.4 (окончание)

Фактор

(GTF)

Молекулярные массы субъединиц (кДа) и их обозначение

Характеристика

TFIIE

56

34

Ассоциированы с Pol II (другое название – RAP), обладают Zn-связывающими доменами, обе субъединицы участвуют в плавлении промотора, обеспечивают вхождение TFIIH в прединициационный комплекс

TFIIF

58 (RAP74)

26 (RAP30)

Стимулирует элонгацию, фосфорилируется in vivo

Гомолог -фактора РНК-полимеразы E. coli, предотвращает неспецифическую инициацию транскрипции

TFIIH

89 (ERCC3)

80 (ERCC2)

62 (p62)

44 (hSSL1)

40 (cdk7)

37 (циклин H)

34 (p34)

32 (MAT-1)

3’5’-Хеликаза, необходимая для транскрипции; участвует в эксцизионной репарации ДНК

5’3’-Хеликаза, необходимая для транскрипции; участвует в эксцизионной репарации ДНК

Участвует в эксцизионной репарации ДНК

Содержит Zn-связывающий домен, участвует в эксцизионной репарации ДНК

Киназа С-концевого домена Pol II (CTD-киназа), компонент cdk7-активирующей киназы (CAK)

Содержит Zn-связывающий домен, гомологичный hSSL1

Содержит Zn-связывающий домен; фактор сборки CAK

TFII I

120

Связывает INR-элемент (инициатор), облегчает связывание TBP

 

Ко второму классу относятся факторы транскрипции, специфически взаимодействующие с определенными последовательностями ДНК, которые являются основными регуляторами транскрипции и обеспечивают тканеспецифическую экспрессию генов. И, наконец, третий класс факторов транскрипции (в том числе многочисленные TAF-белки (TAB-associated factors)) представлен недавно открытыми белками – коактиваторами транскрипции, которые действуют согласованно с основными и тканеспецифическими факторами, обеспечивая более тонкую регуляцию транскрипции. О двух последних классах факторов транскрипции речь пойдет в разделе 3.2.2.

Первым с TATA-последовательностью промотора взаимодействует белковый комплекс TFIID (transcription factor II D), в состав которого входят белок, связывающий TATA-последовательность (TBP), а также еще по меньшей мере девять белковых субъединиц (см. рис. I.7,а). Белок TBP необходим и для осуществления транскрипции РНК-полимеразами I и III, он является универсальным фактором транскрипции у эукариот. Взаимодействие TBP с TATA-последовательностью характеризуется значительным изменением структуры ДНК в этом месте, сопровождаемым частичным разворачиванием двойной спирали. После взаимодействия с TATA-последовательностью TFIID приобретает способность ассоциироваться с факторами TFIIA и TFIIB. Присутствие TFIIB делает возможным вхождение РНК-полимеразы II в прединициационный комплекс. Присоединение РНК-полимеразы II к комплексу сопровождается связыванием с ней дополнительных факторов TFIIE, TFIIF, TFIIH и TFIIJ, что завершается образованием так называемого закрытого прединициационного комплекса (см. рис. I.7,б). Свое название комплекс получил благодаря тому, что участок ДНК промотора, входящий в его состав, в основном сохраняет свою исходную вторичную структуру – обе цепи ДНК связаны друг с другом водородными связями. В инициационном комплексе происходит локальное плавление, т.е. раскрытие соответствующего участка ДНК, и комплекс становится способным к инициации транскрипции. Аминокислотные последовательности отдельных субъединиц факторов TFIIB, TFIIE и TFIIF обнаруживают явную гомологию с последовательностями 70-фактора РНК-полимеразы E. coli. Это может указывать на определенную общность функций и эволюционного происхождения про- и эукариотических факторов транскрипции.

После сборки прединициационный закрытый комплекс претерпевает температурно-зависимые конформационные изменения, что необходимо для образования активного инициирующего транскрипционного комплекса. Показано, что в закрытом комплексе холофермент РНК-полимеразы E. coli взаимодействует с молекулой ДНК лишь с одной ее стороны, тогда как в промежуточном и открытом комплексах - и ‘-субъединицы РНК-полимеразы полностью охватывают молекулу ДНК в окрестностях точки инициации транскрипции. Конформационный переход промежуточного прединициационного комплекса в открытый сопровождается локальным плавлением двойной спирали ДНК между нуклеотидами в положениях 10 и +3 с образованием коротких одноцепочечных участков ДНК. При наличии открытого инициационного комплекса в присутствии четырех рибонуклеозидтрифосфатов может происходить инициация транскрипции, сопровождаемая синтезом коротких (до 7–8 нуклеотидов) олигорибонуклеотидов, непрерывно освобождающихся из транскрипционного комплекса в том случае, если синтез РНК не может быть продолжен (например из-за отсутствия очередного нуклеотида). Эта стадия синтеза РНК получила название абортивной транскрипции. После синтеза РНК длиной более девяти нуклеотидов фермент покидает промотор, у РНК-полимеразы E. coli происходит отделение -фактора от инициационного комплекса, формируется стабильный элонгирующий комплекс, и реакция транскрипции вступает в фазу элонгации.

Фаза абортивной транскрипции характерна для прокариотических и эукариотических РНК-полимераз. Однако переход от стадии абортивной транскрипции к продуктивной элонгации у эукариот характеризуется рядом особенностей. В отличие от РНК-полимеразы E. coli (а также эукариотических РНК-полимераз I и III), РНК-полимераза II содержит в С-концевом домене большой субъединицы гексапептидный повтор (до 52 повторяющихся последовательностей) CTD (carboxy terminal domain), который является субстратом протеинкиназы. В прединициационном комплексе эта последовательность аминокислотных остатков частично фосфорилирована, тогда как у активно элонгирующей РНК-полимеразы CTD фосфорилирован полностью по остаткам Ser и Thr. Несмотря на то, что in vitro многие протеинкиназы обладают способностью фосфорилировать CTD, биологические функции в данном процессе приписывают протеинкиназе фактора TFIIH. Дополнительные исследования показали, что эта протеинкиназа идентична киназе cdk7, участвующей в регуляции клеточного цикла. Предполагается, что in vivo частичное фосфорилирование CTD-домена удерживает молекулу РНК-полимеразы II на промоторе, и его полное фосфорилирование необходимо для того, чтобы фермент покинул промотор и перешел к элонгации вновь синтезируемых цепей РНК. Этот процесс получил название "освобождение промотора" (promoter clearance (escape)) (см. рис. I.7,б). Кроме того, переход закрытого прединициационного комплекса, образованного РНК-полимеразой II, в открытый инициационный комплекс является ATP-зависимым процессом.

В заключение необходимо еще раз вспомнить о том, что многие клеточные белки могут выполнять более одной функции, что является основой тесного сопряжения биохимических реакций, вовлеченных в процессы реализации генетической информации. В частности, многие (пять из девяти) субъединицы TFIIH служат основными компонентами системы эксцизионной репарации ДНК (см. табл. I.4, а также раздел 5.2.2). Такое сопряжение приводит к более эффективной репарации повреждений ДНК в активно транскрибируемых генах по сравнению с молчащими последовательностями ДНК.

Элонгация цепей РНК. Момент перехода РНК-полимеразы от инициации транскрипции к элонгации точно не определен. Три основных биохимических события характеризуют этот переход в случае РНК-полимеразы E. coli: отделение -фактора, первая транслокация молекулы фермента вдоль матрицы и сильная стабилизация транскрипционного комплекса, который кроме РНК-полимеразы включает растущую цепь РНК и транскрибируемую ДНК. Все те же явления характерны и для РНК-полимераз эукариот, хотя в этом случае момент перехода от инициации к элонгации еще более неопределенен. И в том, и в другом случае переход от инициации к элонгации сопровождается разрывом связей между ферментом, промотором, факторами инициации транскрипции, а в ряде случаев – переходом РНК-полимеразы в состояние компетентности в отношении элонгации (например фосфорилирование CTD-домена у РНК-полимеразы II). Фаза элонгации заканчивается после освобождения растущего транскрипта и диссоциации фермента от матрицы (терминация).

Биохимические особенности элонгации. РНК-полимеразы являются процессивными ферментами: если фермент освобождает растущую цепь РНК до завершения транскрипции гена, то он не в состоянии связать эту РНК вновь и продолжить транскрипцию. Поэтому каждый новый раунд синтеза РНК начинается с реинициации транскрипции на промоторе. Такие биохимические особенности РНК-полимераз объясняют, почему стабильность транскрибирующего комплекса является одним из его критических свойств. Действительно, многие гены эукариот обладают очень большими размерами (длина гена дистрофина человека, например превышает 2000 т.п.о. и его транскрипция продолжается  17 ч), следовательно, преждевременная терминация транскрипции могла бы с большой вероятностью прекратить экспрессию таких генов вообще. Из этих соображений не удивительно, что тройной комплекс РНК-полимераза–РНК–матрица чрезвычайно стабилен. Такие комплексы устойчивы к высокой ионной силе, допускают очистку гель-фильтрацией, преципитацию антителами, остаются активными после проведения электрофореза в неденатурирующих условиях и могут храниться в отсутствие рибонуклеозидтрифосфатов при +4оС в течение нескольких дней без потери активности.

В настоящее время разработаны методы, позволяющие задерживать элонгирующую РНК-полимеразу бактерий в любом участке матрицы путем удаления из реакционной смеси одного из рибонуклеозидтрифосфатов. При таком подходе РНК-полимеразу иммобилизуют на носителе, и процесс транскрипции осуществляют непосредственно в колонке, последовательно добавляя нуклеотид за нуклеотидом после отмывания предыдущего. Это дает возможность последовательно перемещать РНК-полимеразу от одного нуклеотида к другому вдоль матрицы, как бы шагать вдоль матричной ДНК (walking). Такой метод является прекрасным инструментом для исследования механизмов элонгации и обнаружения факторов транскрипции, оказывающих влияние на этот процесс.

Скорости транскрипции матричной ДНК РНК-полимеразами сильно различаются. Обнаружена слабая корреляция между субъединичным строением РНК-полимераз и скоростью, с которой они способны элонгировать ДНК. Так, РНК-полимеразы бактериофагов, состоящие из одной субъединицы, являются наиболее быстрыми среди ДНК-зависимых РНК-полимераз. Они способны элонгировать in vitro растущую цепь РНК со скоростью 200–400 нт/с. Бактериальные РНК-полимеразы транскрибируют ДНК с промежуточной скоростью – 50–100 нт/с, тогда как скорость элонгации РНК-полимеразой II многоклеточных организмов in vitro составляет всего 5–10 нт/с. Эукариотические РНК-полимеразы элонгируют цепи РНК in vivo со скоростью 20–30 нт/с.

Точность транскрипции, осуществляемой РНК-полимеразами, ниже соответствующего параметра ДНК-полимераз. Частота ошибок в виде включенных в РНК некомплементарных матрице нуклеотидов составляет 10-3–10-5. Это объясняется, прежде всего, тем, что РНК-полимеразы лишены корректирующей системы в виде 3’5’- и 5’3’-экзонуклеазной активности. В определенных условиях РНК-полимеразы обладают способностью отщеплять 3’-концевую часть транскрипта, находящегося в составе тройного комплекса (см. ниже). Однако до сих пор не ясно, имеет ли эта активность отношение к коррекции ошибок. С эволюционной точки зрения понятно, почему точность транскрипции в меньшей степени подвержена давлению отбора по сравнению с точностью репликации. Действительно, если ошибки репликации должны сопровождаться изменением генотипа клетки или организма, то ошибки транскрипции не приводят к таким последствиям.

Структура элонгирующего комплекса. Основные черты структуры тройного комплекса, осуществляющего элонгацию цепей РНК, консервативны у всех ДНК-зависимых РНК-полимераз (см. рис. I.8). В каждом элонгирующем комплексе имеются каталитический центр, одноцепочечная область ДНК-матрицы, а также несколько сайтов связывания ДНК и РНК. Для реализации принципа комплементарности при построении растущей цепи РНК участок матричной ДНК, входящий в состав комплекса, находится в расплавленном состоянии, и одна из его цепей служит матрицей при транскрипции. Этот участок ДНК, называемый транскрипционным пузырьком, или транскрипционной сферой (transcription bubble), контактирует с каталитическим центром РНК-полимеразы. По обеим сторонам транскрипционного пузырька имеются участки ДНК, которые при перемещении фермента вдоль матрицы подвергаются плавлению (расплетанию) и повторному отжигу, в результате которого восстанавливается исходная структура ДНК. Считается, что этот процесс не является каталитическим, протекает самопроизвольно и связан с особенностями структуры РНК-полимеразы как таковой.

В молекуле РНК-полимеразы имеются несколько участков связывания матричной ДНК и участок связывания растущей цепи РНК, которые обеспечивают точное расположение 3’-ОН-конца РНК относительно транскрибируемого в данный момент нуклеотида матрицы и соответствующего субстрата. В ранних моделях элонгирующего комплекса постулировалось существование короткого гибрида между матричной ДНК и строящейся цепью РНК, однако в настоящее время эта модель подвергается сомнению. Считается, что если гибрид существует, то его длина составляет лишь 2–12 п.о. Современные модели элонгирующего комплекса предполагают наличие механизма, обеспечивающего выбор правильного нуклеотида из пула субстратов. Хотя в принципе этот процесс может быть исключительно следствием комплементарного взаимодействия нуклеотида и матрицы, более распространена точка зрения, согласно которой ключевую роль здесь играет сама молекула РНК-полимеразы, пространственная структура которой формируется при ее контакте с ДНК и растущим транскриптом.

В современных моделях структуры элонгирующего комплекса предполагают наличие в РНК-полимеразе двух сайтов, удерживающих растущую цепь РНК, и двух участков связывания ДНК-матрицы. В совокупности эти участки связывания обеспечивают замечательную стабильность комплекса. Тем не менее, точное положение этих сайтов связывания нуклеиновых кислот в настоящее время неизвестно. Для РНК-полимеразы E. coli имеются доказательства того, что задняя часть элонгирующего фермента контактирует с двухцепочечной ДНК, а передняя – с одноцепочечной, причем с ее транскрибируемой (матричной) цепью.

Способы блокировки элонгации растущих цепей РНК. Элонгация РНК не происходит с постоянной скоростью. Во время элонгации РНК-полимераза может получать сигналы, вызывающие задержку транскрипции (pause), ее прекращение (arrest), или терминацию. В результате задержки молекула РНК-полимеразы временно останавливает синтез РНК на определенный период времени, после чего спонтанно продолжает транскрипцию. В отличие от этого, элонгирующие комплексы, прекратившие синтез РНК, неспособны продолжить транскрипцию без помощи дополнительных факторов. Сигналы, вызывающие такое поведение РНК-полимеразы, могут быть внутренними, в виде определенной последовательности нуклеотидов транскрибируемой ДНК, или внешними – в виде специфических белков-регуляторов, связавшихся с матрицей. Прекращение транскрипции может быть вызвано и в искусственных условиях при отсутствии одного или нескольких рибонуклеозидтрифосфатов. Как во время задержки, так и во время прекращения синтеза РНК РНК-полимераза остается каталитически активной, стабильно связанной с ДНК и удерживает растущий транскрипт в составе тройного комплекса. Именно эти характерные особенности отличают РНК-полимеразу в состоянии задержки или прекращения синтеза РНК от фермента, находящегося в фазе терминации транскрипции. Во многих случаях, когда невозможно четко дифференцировать три вышеупомянутых состояния транскрипции, говорят просто о блокировке синтеза РНК.

Как остановка, так и прекращение синтеза РНК характеризуются двумя параметрами – временем полужизни блокированного состояния комплекса и эффективностью распознавания сигнала. Под временем полужизни блокировки элонгации понимают промежуток времени, за который половина блокированных молекул РНК-полимеразы вступает в фазу продолжения синтеза РНК. Остановка может быть настолько кратковременной, что время полужизни блокированного комплекса невозможно точно определить; в то же время задержка элонгации может продолжаться в течение нескольких минут, что зависит от локализации и структуры соответствующего сайта на матричной ДНК. Эффективность распознавания сигнала блокировки определяется долей молекул РНК-полимеразы, отвечающих прекращением элонгации на соответствующем сайте, и может принимать значения от нескольких до 90%. Описано несколько сайтов, обладающих эффективностью 100%.

Временные остановки элонгирующей РНК-полимеразы на транскрибируемой ДНК бактериофага Т7 были обнаружены в бесклеточных системах, синхронизированных в отношении инициации синтеза РНК. Неожиданно оказалось, что молекулы РНК-полимеразы, синхронно инициировавшие транскрипцию с одного промотора, быстро и специфически распределяются в составе тройного комплекса вдоль матрицы, оставаясь ассоциированными с растущими цепями РНК дискретной длины. Исследование этого феномена привело к заключению о временных остановках РНК-полимеразы во время транскрипции в определенных участках матрицы и было одним из первых доказательств того, что синтез РНК не является непрерывным процессом. Такие врéменные задержки во время элонгации характерны для многих РНК-полимераз, включая РНК-полимеразы I, II и III эукариотических организмов. Как у прокариот, так и у эукариот имеются многочисленные механизмы, регулирующие эффективность задержки транскрипции в определенных сайтах транскрибируемой ДНК (подробнее см. раздел 3.2).

В отличие от описанной выше врéменной задержки транскрипции, полное прекращение элонгации РНК внутри транскрибируемого гена физически блокирует перемещение вдоль гена других молекул РНК-полимеразы, инициировавших транскрипцию на тех же промоторах. Следствием этого является полное прекращение транскрипции такого гена, что служит одним из распространенных механизмов регуляции экспрессии генов на уровне элонгации РНК. Состояние прекращения элонгации РНК-полимеразой может возникать на некоторых участках матрицы in vitro в отсутствие одного или нескольких рибонуклеозидтрифосфатов. В этом случае, в отличие от временной задержки транскрипции, добавление в бесклеточную систему недостающих нуклеотидов не приводит к возобновлению синтеза РНК. Большинство тройных комплексов, прекративших транскрипцию по такому механизму, являются стабильными, а входящая в их состав РНК-полимераза полностью сохраняет свою активность. Переход элонгирующих комплексов из состояния врéменной задержки в состояние полного прекращения транскрипции происходит постепенно, по мере увеличения времени инкубации бесклеточной системы в отсутствие субстратов. В настоящее время не существует прямых доказательств наличия феномена полного прекращения элонгации in vivo. Однако по ряду косвенных данных, включая открытие белков, реактивирующих такие тройные комплексы, считается, что полное прекращение транскрипции имеет место также в клетках живого организма и является одним из регуляторных механизмов, координирующих экспрессию генов на уровне транскрипции. Задержка и полное прекращение транскрипции во время элонгации цепей РНК становятся возможными благодаря взаимодействиям между РНК-полимеразой, растущей цепью РНК и транскрибируемой ДНК и не требуют участия дополнительных факторов. Несмотря на интенсивные исследования, до сих пор не удается предсказывать места задержки элонгации РНК на матричных ДНК.

Природа сигналов, обеспечивающих задержку элонгирующих тройных комплексов у прокариот. Сигналы, вызывающие задержку элонгации, многокомпонентны. Они включают элементы как РНК, так и ДНК. Во многих сайтах задержки элонгации РНК-полимераза синтезирует участок РНК, который имеет склонность образовывать стабильную вторичную структуру. В этом случае мутации, разрушающие шпильку, уменьшают время полужизни комплекса в состоянии задержки элонгации. И наоборот, мутации, восстанавливающие вторичную структуру, увеличивают время полужизни таких комплексов. Это указывает на то, что сама вторичная структура, а не конкретная последовательность нуклеотидов внутри шпильки существенна для задержки элонгации растущей цепи РНК. В пользу этого вывода свидетельствует и тот факт, что включение в РНК IMP вместо GMP, приводящее к снижению числа водородных связей в шпильках, а следовательно, и их прочности, приводит к элиминации некоторых мест задержки элонгации. Тем не менее, образование шпильки в РНК еще не является достаточным условием задержки транскрипции в соответствующем участке матрицы, так как многие места задержки не содержат таких последовательностей. Последовательности ДНК и РНК, расположенные между основанием шпильки и активным центром РНК-полимеразы, также оказывают влияние на задержку элонгации. Замены нуклеотидов в 3'-концевых частях таких последовательностей сопровождаются изменениями времени полужизни комплекса в состоянии задержки. Полагают, что в этом случае вторичная структура РНК не имеет отношения к наблюдаемым эффектам.

Сигналы задержки элонгации могут действовать не только через РНК, но и на уровне ДНК. Так, последовательности, расположенные даже на 17 нуклеотидов ниже участка задержки транскрипции, оказывают влияние на задержку. Полагают, что одной из причин этого может быть воздействие таких последовательностей на способность РНК-полимеразы создавать локально расплетенный участок матричной ДНК. Альтернативным объяснением является влияние таких участков матричной ДНК на конформацию РНК-полимеразы. В случае РНК-полимеразы E. coli эти участки ДНК находятся в контакте с ферментом в одном из его ДНК-связывающих сайтов. С помощью мутационного анализа было установлено, что на задержку элонгации могут оказывать влияние и последовательности нуклеотидов нематричной цепи ДНК.

Природа прокариотических сигналов, вызывающих прекращение элонгации РНК. Так же как и в предыдущем случае, природа сигналов, вызывающих прекращение элонгации, не вполне ясна. В окрестностях сайтов на ДНК, вызывающих прекращение элонгации, не обнаружено каких-либо канонических последовательностей. К этому феномену может быть причастна вторичная структура РНК, поскольку замещение GMP на IMP, приводящее к ослаблению вторичной структуры РНК, во многих случаях предотвращает прекращение транскрипции в соответствующих участках ДНК. Большинство элонгирующих комплексов, прекративших транскрипцию, было получено в искусственных условиях при недостатке рибонуклеозидтрифосфатов. В отличие от сигналов задержки транскрипции, ни один из сигналов прекращения транскрипции не был обнаружен внутри прокариотических генов.

Сигналы остановки транскрипции на уровне элонгации у эукариот. Участки ДНК, вызывающие задержку и прекращение элонгации у эукариот, охарактеризованы слабо. Имеются данные, что в случае РНК-полимераз I и II такие участки ДНК часто содержат Т-богатые последовательности в нематричной цепи, однако это не является общим правилом. Если такие Т-богатые участки существуют, то в них часто происходит формирование изгиба ДНК, а эффективность блока прямо пропорциональна длине Т-богатой последовательности. Наличие шпилек в транскриптах этих участков не всегда требуется для блокировки транскрипции. В случае РНК-полимеразы II существенным моментом блокировки является взаимодействие каталитического сайта фермента с ниже расположенными последовательностями ДНК. При этом задержанный комплекс с течением времени может превращаться в комплекс, полностью прекративший транскрипцию. Эффективность распознавания РНК-полимеразой участков задержки на ДНК зависит от свойств промотора, на котором произошла инициация транскрипции, а также расстояния сайта блокировки от промотора. Как у прокариот, так и у эукариот специфические белки оказывают сильное влияние на способность РНК-полимеразы распознавать участки задержки и прекращения транскрипции. Многие из этих белков участвуют в регуляции транскрипции на уровне элонгации.

Внешние факторы, блокирующие элонгацию цепей РНК. В дополнение к только что рассмотренным внутренним сигналам, препятствующим элонгации РНК, существует большое число внешних факторов, оказывающих влияние на этот процесс. Имеется много примеров, когда ДНК-связывающие белки блокируют элонгацию цепей РНК вирусными, прокариотическими и эукариотическими РНК-полимеразами как в природных условиях, так и в бесклеточных системах. Однако во многих случаях РНК-полимеразы способны обходить ДНК-связывающие белки без задержки транскрипции. Хотя белки являются основным препятствием на пути элонгации РНК, имеются и другие факторы, оказывающие подобное влияние на элонгацию. В частности, показано, что интенсивное негативное и позитивное суперскручивание ДНК-матрицы может увеличивать время полужизни элонгирующих комплексов в задержанном состоянии. ДНК в Z-форме также может ингибировать элонгацию. Многие вещества, взаимодействующие с ДНК, а также повреждения ДНК ингибируют элонгацию. Интересно, что РНК-полимераза E. coli способна преодолевать участки ДНК с отсутствующими азотистыми основаниями. Еще более удивительной является способность Т7-РНК-полимеразы не замечать короткие бреши в матричной цепи ДНК длиной в 1–5 нуклеотидов. Она может перебираться через бреши даже длиной в 24 нуклеотида, хотя и с меньшей эффективностью. Прохождение РНК-полимеразы через такие бреши сопровождается образованием единого транскрипта, содержащего делецию в соответствующем участке РНК. Способность РНК-полимеразы транскрибировать ДНК, содержащие бреши, зависит от природы 3’-концевого нуклеотида, после которого начинается брешь: 3’-ОН-конец допускает транскрипцию, тогда как 3’-фосфат блокирует элонгацию.

Расщепление транскрипта в комплексах, полностью прекративших элонгацию. РНК-полимеразы в составе тройных комплексов, включая все три РНК-полимеразы эукариот и РНК-полимеразу E. coli, способны осуществлять эндонуклеазное расщепление растущей цепи РНК вблизи ее 3’-конца. Образующийся в результате более протяженный 5’-концевой фрагмент РНК остается прочно связанным с ферментом, тогда как 3’-концевой фрагмент освобождается из тройного комплекса. При этом каталитический центр РНК-полимеразы остается правильно ориентированным в отношении оставшегося транскрипта и ДНК-матрицы, и она способна продолжать транскрипцию, не образуя в синтезируемой РНК внутренних делеций. Реакция расщепления не является пирофосфоролизом, поскольку в результате пирофосфоролиза формируется фрагмент РНК, содержащий 5’-концевой нуклеозидтрифосфат, а при расщеплении транскрипта РНК-полимеразой образуется фрагмент РНК с монофосфатом на 5'-конце. Белки E. coli GreA и GreB, а также эукариотический фактор транскрипции TFIIS стимулируют процесс расщепления. Те же факторы и, кроме того, состав тройного комплекса оказывают влияние на размер освобождающегося в процессе расщепления 3’-концевого фрагмента РНК, который может варьировать от 1 до 17 нуклеотидов. В разных тройных комплексах процесс расщепления может происходить мгновенно или растягиваться на несколько часов. Полагают, что кинетика этого процесса зависит от конформации тройного комплекса, которая может быть различной в разных участках матричной ДНК.

Имеются доказательства того, что расщепление транскрипта катализируется одним активным центром фермента, ответственным, кроме того, за полимеризацию рибонуклеозидтрифосфатов и пирофосфоролиз РНК. В частности, было показано, что неорганический пирофосфат может индуцировать освобождение олигонуклеотидного фрагмента РНК, содержащего 5’-концевую трифосфатную группу, из тройного комплекса, прекратившего синтез РНК. Эти данные интерпретируются в пользу того, что активный центр РНК-полимеразы, прекратившей транскрипцию, смещается от 3’-конца элонгируемого транскрипта к его 5’-концу, где он и катализирует пирофосфоролитическое расщепление РНК. Кроме того, до настоящего времени не обнаружено ингибиторов расщепления транскрипта, которые одновременно не подавляли бы самого синтеза РНК. Не найдено и мутантов, у которых оба этих процесса были бы разделены. И, наконец, расщепление транскрипта и полимеризация субстратов происходят в одинаковых условиях: в присутствии двухвалентных катионов с одним и тем же оптимумом рН реакционной смеси.

Физиологическое значение реакции расщепления транскрипта РНК-полимеразой еще предстоит выяснить. Известно, что факторы GreA и TFIIS, которые стимулируют расщепление РНК, одновременно подавляют образование прекративших транскрипцию комплексов. В соответствии с наиболее распространенной точкой зрения расщепление транскрипта помогает РНК-полимеразе выйти из состояния полного прекращения транскрипции. Полагают, что в тройном комплексе, прекратившем транскрипцию, активный центр РНК-полимеразы постепенно смещается от 3’-конца РНК к 5’-концу и утрачивает способность ее элонгировать. Эндонуклеазное расщепление транскрипта правильно ориентирует новый 3’-концевой нуклеотид РНК относительно активного центра РНК-полимеразы, что реактивирует процесс транскрипции. Другой возможной функцией расщепления РНК молекулой РНК-полимеразы может быть коррекция ошибочно включенных в растущую РНК 3’-концевых нуклеотидов. Если после включения некомплементарного матрице нуклеотида в РНК молекула РНК-полимеразы делает паузу в элонгации, то вырезание 3’-концевого фрагмента растущей цепи РНК и продолжение элонгации можно рассматривать как имитацию РНК-полимеразой хорошо известной 3’5’-экзонуклеазной корректирующей активности ДНК-полимеразы I E. coli. Такой механизм может помогать РНК-полимеразе в преодолении физических препятствий во время транслокации. Известно, что места задержки транскрибирующей РНК-полимеразы на ДНК распознаются молекулами фермента, находящимися в определенной фазе (рамке считывания) по отношению к этим сайтам. Поскольку отщепление 3-концевого участка ДНК и обратная транслокация могут перевести фермент в новую фазу по отношению к сайтам задержки на ДНК, то фермент, начиная транскрипцию из нового положения, сможет беспрепятственно преодолевать сайты задержки в процессе элонгации. Одним из таких преодолеваемых при транскрипции барьеров для РНК-полимеразы у эукариот могут быть, в частности нуклеосомы.

Помимо всего прочего, в настоящее время показано, что вышеупомянутые факторы GreA и GreB стимулируют процесс освобождения промоторов бактериальными РНК-полимеразами.

Реитеративный синтез гомополимеров. Молекулы РНК, обычно синтезируемые РНК-полимеразами, строго комплементарны транскрибируемым участкам матричной РНК. Однако в редких случаях in vivo, а также в определенных искусственных условиях РНК-полимеразы способны осуществлять так называемый реитеративный синтез гомополимеров, во время которого молекула РНК-полимеразы, многократно проскальзывая вдоль короткой гомополимерной последовательности (transcriptional slippage), синтезирует длинные комплементарные этой последовательности гомополимеры – поли(А), поли(U) или поли(С). Размеры образующихся при этом гомополимерных продуктов могут более чем в 10–20 раз превышать длину матричной последовательности. Реитеративный синтез протекает особенно эффективно на одноцепочечных ДНК в присутствии ионов Mn2+ вместо Mg2+ и необходимого рибонуклеозидтрифосфата. Если же олигонуклеотидная последовательность матрицы включена в случайную последовательность, то реитеративного синтеза не происходит при наличии в реакционной смеси кроме нуклеотида, составляющего гомополимер, других рибонуклеозидтрифосфатов. Это обусловлено пребыванием тройного комплекса в состоянии обычной элонгации.

Реитеративный синтез гомополимеров РНК-полимеразами может происходить как во время инициации транскрипции, так и в фазе элонгации. При инициации РНК-полимераза может начинать реитеративный синтез при наличии в окрестностях точки инициации транскрипции гомополимера длиной в 3 и даже 2 нуклеотида. Во время элонгации РНК-полимераза предпочитает осуществлять реитеративный синтез на более длинных гомополимерных последовательностях. В частности, в двух исследованных случаях элонгирующая РНК-полимераза E. coli осуществляла реитеративный синтез поли(A) или поли(U) на последовательностях, состоящих из dT или dA, длиной в 10 нуклеотидов.

Несмотря на то что реитеративный синтез гомополимеров является редким событием in vivo, он выполняет определенные функции в регуляции транскрипции. Показано, что проскальзывание РНК-полимеразы вдоль гомополимерных последовательностей матрицы может быть механизмом, изменяющим рамки считывания мРНК при трансляции, редактирующим генетическую информацию мРНК, осуществляющим присоединение к РНК поли(А)-хвостов и 5'-концевых последовательностей к вирусным РНК, а также регулирующим инициацию транскрипции некоторых бактериальных оперонов (например pyrBI или codBA). Поскольку нерегулируемый реитеративный синтез внутри кодирующих частей генов таит большую опасность для их экспрессии, предполагают, что гомополимерные последовательности в транскрипционных единицах являются мишенью для эволюционного отбора, который их элиминирует. Действительно, компьютерный анализ под этим углом зрения последовательностей нуклеотидов E. coli показал отсутствие достаточно протяженных гомополимеров в кодирующих частях генов и их наличие в некодирующих последовательностях бактериального генома.

Современные модели структуры элонгирующих тройных комплексов и механизма элонгации растущих цепей РНК. В 1992 г. М. Чамберлин с сотрудниками разработали модель элонгации РНК, которая содержала целый ряд новых идей. Прежде всего было постулировано, что процессы транслокации РНК-полимеразы вдоль ДНК и присоединение нуклеотидов к растущей цепи РНК в активном центре фермента разделены во времени. Это разделение становится возможным благодаря наличию в молекуле РНК-полимераз двух ДНК-связывающих сайтов, каждый из которых перекрывает на матричной ДНК  10 нуклеотидных пар (см. рис. I.8). Сайт I локализован в задней по отношению к направлению транскрипции части фермента, а сайт II – в передней. Предполагалось также, что эти два сайта могут перемещаться вдоль ДНК в процессе элонгации независимо друг от друга. В соответствии с предложенной моделью, молекула РНК-полимеразы перемещается вдоль ДНК наподобие гусеницы: когда один из сайтов связывания ДНК фиксирован, другой может двигаться вперед. Еще одной новой чертой модели было предположение о том, что растущая цепь РНК удерживается внутри элонгирующего комплекса не 12-нуклеотидным ДНК–РНК-гибридом, а двумя сайтами связывания самой РНК-полимеразы, каждый из которых перекрывает 10 нуклеотидов матрицы. При этом длина участка РНК, заключенного между сайтами связывания, составляет 30–40 нуклеотидов. Предполагалось также, что перемещение каталитического центра молекулы РНК-полимеразы сопряжено с движением переднего сайта связывания ДНК II и может происходить независимо от переноса заднего сайта I вперед вдоль РНК-связывающего сайта I во время добавления нуклеотидов к растущей цепи РНК, сопровождаемого заполнением этого сайта (см. рис. I.8,б,1).

Согласно предложенной модели элонгация цепей РНК представляется в виде циклического процесса. В начале цикла каталитический центр молекулы РНК-полимеразы располагается у задней границы РНК-связывающего сайта I в соответствии с положением 3’-ОН-конца РНК. Последовательно присоединяя нуклеотиды к растущей цепи РНК, каталитический участок перемещается относительно РНК-связывающего сайта I и в конце концов заполняет этот сайт десятью нуклеотидами вновь синтезированного участка РНК (см. рис. I.8,б,1). Во время этой фазы элонгации ДНК-связывающий сайт I остается фиксированным на ДНК, тогда как ДНК-связывающий сайт II перемещается вперед синхронно с каталитическим участком на десять нуклеотидов. В конце фазы добавления нуклеотидов ДНК- и РНК-связывающие сайты II фиксируются на своих лигандах, а ДНК-связывающий сайт I переносится вперед на десять нуклеотидов в новое фиксированное положение. Это перемещение освобождает РНК-связывающий сайт I, делая его готовым к повторению цикла транслокации.

Волна исследований, последовавшая за появлением этих новых идей, быстро подтвердила реальность основных положений модели элонгации транскриптов, выдвинутых группой М. Чамберлина, и дополнила ее рядом существенных моментов. Оказалось, что перемещение тройного комплекса вдоль транскрибируемой ДНК не всегда скачкообразно. Большую часть транскрибируемых ДНК молекулы РНК-полимеразы проходят монотонно, регулярно присоединяя к растущим цепям РНК нуклеотид за нуклеотидом. Прерывистая, скачкообразная элонгация РНК имеет место лишь на участках матричной ДНК, в которых происходит задержка транскрипции или ее полное прекращение. Встретив препятствие на своем пути в виде специфической последовательности нуклеотидов или белков, ассоциированных с ДНК, молекула РНК-полимеразы в составе тройного комплекса переходит во внутренне напряженное состояние, которое она может разрешить тремя путями: или преодолеть препятствие, переместив свою переднюю границу вперед за пределы препятствия, и продолжить монотонную элонгацию транскрипта, или терминировать транскрипцию (см. рис. I.8,б,2), или полностью прекратить синтез РНК. В последнем случае каталитический участок фермента смещается назад по отношению к синтезированной РНК и ее 3’-концевой нуклеотид становится недоступным для элонгации (см. рис. I.8,б,3). Эндонуклеазное отщепление 3’-концевого фрагмента РНК в комплексе, прекратившем элонгацию, реактивирует транскрипцию. Очищенные РНК-полимеразы, особенно РНК-полимераза II эукариот, из-за частых задержек на матрице в процессе элонгации транскрибируют молекулы ДНК со скоростью, по крайней мере, в 10 раз меньшей, чем in vivo. В этом случае стимулирующее действие на элонгацию оказывают специфические факторы элонгации.

Основные факторы элонгации РНК-полимеразы II. У эукариот имеются белковые факторы элонгации РНК, которые относят к двум различным классам: основным (general) и регуляторным факторам. Как и в случае основных факторов инициации транскрипции, основные факторы элонгации РНК обеспечивают эффективную транскрипцию всех генов, кодирующих белки, тогда как регуляторные факторы специфически контролируют экспрессию отдельных генов или даже целых их семейств. Основные факторы элонгации РНК-полимеразы II и некоторые их свойства перечислены в табл. I.5. Первыми в этой таблице упомянуты белки P-TEFb (positive transcript elongation factor b) и SII, которые препятствуют переходу задержанных элонгирующих комплексов РНК-полимеразы II в состояние полного прекращения транскрипции. Активность фактора P-TEFb, впервые

 

Таблица I.5

Основные факторы элонгации РНК-полимеразы II

Фактор

Структура

Молекулярная масса полипептидов, кДа

Функция

P-TEFb

Гетеродимер

124, 43

Препятствует прекращению элонгации, ингибируется DRB

SII (TFIIS)

Мономер

38

Препятствует прекращению элонгации, стимулирует расщепление транскрипта

TFIIF

Гетеродимер

30, 70

Устраняет задержку элонгации РНК

Элонгин (SIII)

Гетеротример, включающий элонгины A, B и С

Та же

 Элонгин А

110

Активная субъединица

 Элонгин В

18

Регуляторная субъединица

 Элонгин С

15

Та же

ELL

80

Устраняет задержку элонгации РНК

Примечание. DRB – 5,6-дихлоро-1--D-рибофуранозилбензимидазол

 

выделенного в гомогенном состоянии из экстрактов Drosophila, подавляется нуклеотидным аналогом – DRB. Фенотипическим проявлением действия этого ингибитора является общее подавление синтеза гяРНК в ядрах вследствие резкого повышения частоты перехода элонгирующего комплекса в состояние полного прекращения транскрипции вблизи промоторов. DRB не подавляет элонгацию цепей РНК в бесклеточных системах транскрипции, реконструированных из высокоочищенных компонентов, что дало основание предполагать наличие дополнительных факторов, которые контролируют процесс перехода комплексов РНК-полимеразы II в фазу элонгации и чувствительны к действию этого ингибитора. Фактор P-TEFb оказался белком, обладающим именно такими свойствами. Механизм действия P-TEFb, благодаря которому этот фактор препятствует прекращению транскрипции РНК-полимеразой II, неизвестен. Предполагают, что он может быть связан с фосфорилированием РНК-полимеразы II или сопутствующих факторов транскрипции.

Небольшой белковый фактор SII, впервые выделенный из клеток асцитной опухоли Эрлиха, обеспечивает преодоление РНК-полимеразой II препятствий в виде нуклеопротеиновых комплексов или специфических последовательностей ДНК, вызывающих преждевременное прекращение транскрипции в кодирующих частях генов. Однако он не оказывает влияния на РНК-полимеразу, прекратившую элонгацию в DRB-чувствительной фазе. Фактор SII стимулирует эндонуклеазное отщепление 3’-концевой части транскрипта в комплексе, прекратившем элонгацию, что дает возможность РНК-полимеразе II продолжить элонгацию цепи РНК. Активный сайт РНК-полимеразы, обладающий такой эндонуклеазной активностью, ингибируется -аманитином – специфическим ингибитором РНК-полимеразы II эукариот. Клетки дрожжей, у которых фактор SII инактивирован под действием мутаций, обладают повышенной чувствительностью к 6-азаурацилу и микофеноловой кислоте, которые, как известно, ингибируют биосинтез нуклеотидов, понижая внутриклеточное содержание GTP и UTP. Это, в свою очередь, оказывает сильное влияние на эффективность элонгации РНК РНК-полимеразой II в мутантных клетках.

Другая группа основных факторов элонгации супрессирует задержку элонгации цепей РНК, тем самым уменьшая вероятность перехода элонгирующих комплексов в состояние полного прекращения элонгации. Эту группу составляют три структурно неродственных белка: факторы TFIIF, элонгин (SIII) и ELL, которые, по-видимому, взаимодействуют непосредственно с компонентами тройного элонгирующего комплекса. Ни один из этих белков не способен реактивировать комплексы, полностью прекратившие транскрипцию, или стимулировать расщепление РНК в этих комплексах. Точный механизм супрессирующего действия данных факторов на задержку элонгации неизвестен. Недавно было установлено, что и элонгин, и фактор TFIIF резко повышают способность РНК-полимеразы II осуществлять зависимое от матрицы присоединение рибонуклеозидтрифосфатов к 3’-OH-концам фрагментов ДНК, которые в этом случае выполняют функцию праймеров. Предполагают, что роль элонгина и фактора TFIIF может заключаться в обеспечении правильного расположения в активном центре элонгирующего фермента 3’-OH-концов растущих транскриптов. Фактор TFIIF занимает особое место среди других основных факторов транскрипции, поскольку только он обладает способностью контролировать активность РНК-полимеразы II как на стадии инициации транскрипции, так и в фазе элонгации. При этом способность этого фактора оказывать действие на инициацию транскрипции или элонгацию контролируется разными доменами его полипептидных цепей.

Элонгин (SIII) впервые был выделен из ядер печени крыс в виде белкового комплекса, состоящего из трех субъединиц A, B и C с молекулярными массами ~150, 18 и 15 кДа соответственно. Транскрипционная активность элонгина (SIII) целиком ассоциирована с его A-субъединицей, а две другие служат регуляторными и после образования стабильного димера оказывают сильное стимулирующее действие на транскрипционную активность A-субъединицы. Собственно стимулятором активности элонгина А является элонгин C, тогда как элонгин B, гомологичный убиквитину, не взаимодействует стабильно с элонгином А в отсутствие элонгина С и выполняет шапероноподобную функцию при сборке всего комплекса элонгина (SIII). На особую роль элонгина (SIII) в регуляции экспрессии генов указывает тот факт, что у человека он известен как потенциальная мишень действия продукта антионкогена (гена-супрессора опухолей) von Hippel–Lindau (VHL), мутации в котором ассоциированы с возникновением многих видов рака у человека. Белок VHL специфически взаимодействует с комплексом элонгина BC, препятствуя его связыванию с элонгином А. При этом мутации в антионкогене, сопровождающие онкологические заболевания, уменьшают прочность взаимодействия мутантного белка с элонгином BC.

Ген фактора элонгации ELL (elevennineteen lysine-rich leukemia) человека, локализованный на хромосоме 19 (19p13.1), первоначально был обнаружен в связи с его частыми транслокациями в ген MLL (mixed lineage leukemia) на хромосому 11 (11q23) при острых миелоидных лейкозах. Предполагают, что продукт гена MLL участвует в регуляции транскрипции гомеозисных генов. В результате транслокации образуется "онкоген", кодирующий гибридный белок, который образован почти полным полипептидом ELL, объединенным с N-концевой частью белка MLL. Роль белка ELL в развитии лейкозов неясна, поскольку в настоящее время обнаружены шесть других генов, претерпевающих транслокацию в то же самое место на хромосоме 11, которые ассоциированы с лейкозами с различными клиническими проявлениями, характер которых зависит от природы транслоцируемого гена.

Терминация транскрипции. Прекращение синтеза РНК под действием РНК-полимеразы и освобождение РНК из транскрипционного комплекса происходят в конце транскрипционных единиц на особых участках ДНК - терминаторах транскрипции. Терминаторы транскрипции, функционирующие с разной эффективностью, могут находиться и внутри транскриптонов. Такие терминаторы являются мощными факторами, регулирующими уровень транскрипции (и других этапов экспрессии) соответствующих генов. Для осуществления терминации транскрипции на некоторых терминаторах РНК-полимеразам не требуется дополнительных белковых факторов, тогда как другие терминаторы в их отсутствие не функционируют.

Терминация транскрипции у бактерий. Типичные терминаторы, не требующие для своего распознавания РНК-полимеразой E. coli дополнительных белковых факторов, содержат GC-богатый участок, обладающий центральной симметрией, вслед за которым располагается последовательность нуклеотидов, состоящая из выстроенных подряд четырех–восьми остатков A, в матричной цепи ДНК. Транскрипция завершается на конце этой олиго(A)-последовательности или же на следующем за ней нуклеотиде. Предполагается, что после прохождения РНК-полимеразой GC-богатого участка ДНК с центральной симметрией в этом месте РНК образуется шпилька, что приводит к разрушению ДНК–РНК-гибрида в транскрибирующем комплексе. Оставшаяся часть ДНК–РНК-гибрида нестабильна и легко плавится, поскольку образована 3’-концевой олиго(U)-последовательностью РНК и олиго(dA)-последовательностью терминатора. Первым из комплекса освобождается РНК-продукт, а затем минимальный фермент РНК-полимеразы. После объединения со свободным -фактором образовавшийся холофермент РНК-полимеразы вступает в новый цикл транскрипции. Эффективность терминации транскрипции на таком терминаторе зависит от стабильности терминаторной шпильки РНК: мутации, нарушающие комплементарное спаривание оснований в шпильке, ослабляют терминацию, а мутации, восстанавливающие комплементарность, ее усиливают.

Кроме вышеописанного, у E. coli обнаружены терминаторы транскрипции, распознаваемые РНК-полимеразой только в присутствии белкового фактора терминации , механизм действия которого хорошо изучен. Этот белок с молекулярной массой 46 кДа обладает РНК-зависимой нуклеозидтрифосфатазной активностью, которая необходима для его функционирования при терминации. Кроме того, для него характерна РНК:ДНК-хеликазная активность. Установлено, что фактор связывается с растущей цепью РНК в особых неструктурированных участках, называемых рат-сайтами (rut sites, от англ. rut – колея, выбоина), до того, как РНК-полимераза достигает терминатора. В местах -зависимой терминации транскрипции РНК-полимераза прекращает элонгацию. Считается, что роль -фактора заключается в вытеснении РНК из транскрипционного комплекса во время таких пауз.

E. coli и другие бактерии имеют еще один тип регулируемых терминаторов транскрипции, называемых аттенюаторами. Впервые обнаружен и лучше других изучен аттенюатор триптофанового оперона, контролирующего биосинтез Trp в бактериальных клетках (см. рис. I.9). В условиях избытка внутриклеточного Trp девять из десяти молекул РНК-полимеразы, начавших транскрипцию триптофанового оперона, прекращают синтез РНК на аттенюаторе, расположенном на расстоянии в 180 п.о. от точки инициации транскрипции. В результате в основном происходит синтез коротких РНК той же длины, называемых лидерными. При уменьшении содержания Trp в клетках доля молекул РНК-полимеразы, преодолевающих аттенюатор, возрастает, что, в конечном счете, сопровождается увеличением внутриклеточного содержания ферментов биосинтеза Trp. Перед аттенюатором находятся несколько участков ДНК, последовательности которых обладают центральной симметрией. Это приводит к тому, что лидерная РНК, включающая в себя последовательности, комплементарные таким участкам, способна образовывать структуры типа шпилек в разных сочетаниях, которые исключают друг друга. Например, если получена шпилька 2/3, то шпильки 1/2 и 3/4 сформироваться уже не могут. К аналогичным результатам приводит и обратное развитие событий. Шпилька 3/4 является терминаторной, присутствующей в -независимых терминаторах. За ней в лидерной РНК располагается последовательность олиго(U). Поэтому образование шпильки 3/4 сопровождается терминацией транскрипции на аттенюаторе и освобождением лидерной РНК из транскрипционного комплекса. Формирование альтернативных шпилек зависит от положения рибосом, транслирующих лидерную РНК с образованием лидерного пептида, в котором присутствуют два остатка Trp подряд. В условиях недостатка Trp рибосома в процессе синтеза лидерного пептида останавливается на соответствующих кодонах лидерной РНК, прикрывая собой последовательность 1, что препятствует формированию шпильки 1/2, так как образуется шпилька 2/3. В соответствии с этим терминаторная шпилька не может сформироваться, транскрипция не прерывается на аттенюаторе и РНК-полимераза переходит в область структурных генов оперона. Если недостаток триптофана не приводит к прекращению трансляции лидерной РНК, рибосома проходит критический участок лидерной РНК, препятствуя формированию шпильки 2/3, и образуется терминаторная шпилька 3/4, что сопровождается терминацией транскрипции на аттенюаторе.

Терминация транскрипции у эукариот. У эукариот обнаружены три фактора терминации транскрипции, необходимых для освобождения РНК-полимераз из транскрипционных комплексов на терминаторах – по одному для РНК-полимераз I, II и III. Белок N-TEF дрозофилы индуцирует освобождение транскриптов, синтезированных РНК-полимеразой II, и при его функционировании происходит расщепление ATP. У дрожжей белковый фактор Reb-1 связывается с природными терминаторами транскрипции на ДНК, обеспечивая как остановку элонгирующей РНК-полимеразы I на этих терминаторах, так и последующее освобождение РНК из транскрипционных комплексов. Удаление в результате делеции из рибосомной транскрипционной единицы Reb-1-связывающего сайта нарушает правильное  образование 3’-концов рРНК in vivo. Мышиный фактор TTF-1, который также является ДНК-связывающим белком, необходим для правильной терминации транскрипции РНК-полимеразой I в клетках этих животных. У них же обнаружен LА-белок, специфически взаимодействующий с РНК, функционирование которого требуется для образования транскриптов полной длины под действием РНК-полимеразы III, что происходит в результате освобождения РНК из транскрипционных комплексов и реинициации транскрипции.

Рассмотрим подробнее механизм терминации транскрипции Pol I. У мышей терминация транскрипции рДНК происходит на 565 п.о. ниже кодирующей части гена 28S РНК. 3'-Конец терминирующего транскрипта картирован за 21 п.о. перед 18-нуклеотидным повтором, названным Sal-боксом (AGGTCGACCAGA/TT/ANTCCG), который входит в состав терминатора транскрипции. Десять таких повторов, фланкированных протяженными кластерами пиримидиновых оснований, локализованы в нетранскрибируемых спейсерах рДНК. У человека длина повтора составляет 11 п.о. (GGGTCGACCAG), и его последовательность соответствует таковой 5'-концевой части мышиного повтора. Последовательности, фланкирующие повторы, оказывают влияние на точность и эффективность терминации транскрипции, а функционирование всего терминатора зависит от его ориентации на ДНК.

С помощью мутационного анализа и футпринтинга было установлено, что фактор терминации транскрипции TTF-I взаимодействует с Sal-боксом и останавливает элонгирующую Pol I. Хотя все факторы терминации транскрипции, обсуждавшиеся выше, распознают разные последовательности нуклеотидов, для них характерно наличие в C-концевых частях двух ДНК-связывающих доменов длиной в 80 аминокислот каждый, гомологичных ДНК-связывающей последовательности онкобелка c-Myb. Хотя более половины полипептидной цепи с N-конца TTF-I могут быть удалены без потери его функций, одних лишь ДНК-связывающих доменов недостаточно для обеспечения белком терминации транскрипции, и для этого требуются прилегающие последовательности аминокислот. Факторы терминации транскрипции TTF-I мышей и Rib-1 дрожжей могут прекращать элонгацию цепей РНК на любой из этих ДНК. Это указывает на высокую эволюционную консервативность механизма терминации транскрипции Pol I.

Связываясь с последовательностями терминаторов, TTF-I изгибает молекулу ДНК и вызывает задержку элонгирующего транскрипционного комплекса на терминаторе. Предполагается, что в этот момент происходит конформационное изменение молекулы Pol I, что ослабляет взаимодействие компонентов комплекса друг с другом (как это имеет место в случае РНК-полимеразы E. coli на ρ-независимых терминаторах транскрипции). Окончательный распад комплекса и освобождение Pol I, а также синтезированной молекулы РНК происходит лишь в присутствии дополнительного фактора PTRF (polymerase and transcript release factor), который контактирует как с Pol I, так и с TTF-I.

Функциональная роль фактора TTF-I не ограничивается лишь участием в терминации транскрипции. Один из терминаторов транскрипции рДНК, так называемый To, расположен за 170 п.о. перед точкой инициации транскрипции генов рРНК. Взаимодействующий с To фактор TTF-I сильно стимулирует транскрипцию генов рРНК, вызывая перестройку структуры хроматина в окрестностях соответствующего промотора. Об изменениях структуры хроматина во время транскрипции см. следующий раздел 2.1.4.

Хотя для каждой из форм РНК-полимераз обнаружен свой специфический белковый фактор, необходимый для правильного освобождения транскриптов из элонгирующих комплексов, этим не ограничиваются механизмы, обеспечивающие терминацию транскрипции у эукариот. Действительно, одним из основных факторов терминации транскрипции у этой группы организмов является сложный белковый комплекс, обеспечивающий процессинг 3’-концевых последовательностей у предшественников мРНК, синтезируемых РНК-полимеразой II (см. ниже). В этом случае терминация транскрипции тесно сопряжена с процессингом пре-мРНК пока неизвестным молекулярным механизмом.

Терминация транскрипции митохондриальных ДНК человека, так же как и терминация синтеза рРНК, требует участия специального белкового фактора. В этом случае фактор mtTERM может ускорять терминацию транскрипции in vivo митохондриальной РНК-полимеразой, а также ферментами бактериального и фагового происхождения. В отличие от терминаторов генов рРНК, митохондриальные сигналы терминации транскрипции в комплексе с фактором mtTERM распознаются молекулами РНК-полимераз в обеих ориентациях, что делает возможной терминацию транскрипции на H- и L-цепях мтДНК. Вследствие этого один общий терминатор может обеспечивать сбалансированное образование продуктов транскрипции с обоих противоположно направленных митохондриальных промоторов.

  1.  Хроматин во время транскрипции

В эукариотических клетках матрицей для РНК-полимераз служит ДНК, находящаяся в составе хроматина. Из общих соображений белки нуклеосом и более высокоорганизованного хроматина должны быть препятствием для образования инициационного комплекса и перемещения транскрипционного комплекса вдоль такой матрицы. Однако in vivo эти препятствия в соответствующих условиях легко преодолеваются. Исследование транскрипции хроматина в настоящее время еще далеко от своего завершения, а основные результаты получены в опытах in vitro. Тем не менее, в последнее время, благодаря взаимно дополняющим друг друга биохимическим и генетическим данным, становятся более ясными основные механизмы, обеспечивающие этот повсеместно распространенный процесс. Результаты такого рода исследований показывают, что наличие нуклеосом предотвращает неспецифическую транскрипцию инактивированных генов и является одним из необходимых условий их правильной экспрессии. Рассмотрим ряд современных моделей, в которых делается попытка объяснения таких механизмов.

Нуклеосомы и инициация транскрипции. Результаты многочисленных биохимических и генетических экспериментов показывают, что присутствие нуклеосом в промоторных участках генов, как правило, ингибирует транскрипцию. В частности,, установлено, что пространственное расположение последовательностей нуклеотидов в двух витках ДНК, намотанной вокруг гистонового октамера нуклеосомы, несовместимо со сборкой стабильного инициационного комплекса. Следовательно, для образования функционально активного инициационного комплекса, в состав которого входят РНК-полимераза и факторы транскрипции, необходимо локальное разрушение нуклеосомной структуры хроматина в окрестностях промотора и регуляторных элементов. При этом реализуются две стратегии: непрерывное существование участка ДНК в виде свободной от нуклеосом последовательности нуклеотидов и индуцированное разрушение нуклеосом. Первый механизм функционирует на промоторах конститутивно транскрибируемых эукариотических генов и обеспечивается белковыми факторами, которые разрушают имеющуюся нуклеосомную структуру данного участка ДНК или препятствуют ее образованию. Описаны, по крайней мере, три способа осуществления этого механизма: 1) факторы транскрипции успевают взаимодействовать с реплицируемой ДНК до сборки нуклеосом; 2) факторы связываются с соответствующими участками ДНК, содержащими нуклеосомы, и их дестабилизируют; 3) специализированные белки разрушают нуклеосомную структуру в области промоторов неэкспрессирующихся генов. Все эти механизмы могут функционировать как по отдельности, так и в различных сочетаниях.

Вновь синтезируемая эукариотическая ДНК обладает повышенной чувствительностью к нуклеазам, что указывает на ее более "открытую" структуру по сравнению со структурой в сформированном хроматине интерфазных ядер. Это может отражать наличие промежуточных стадий в сборке нуклеосом или формировании структур хроматина более высокого порядка. Считается, что сборка нуклеосом в реплицирующейся ДНК происходит в два этапа. Вначале гистоны H3 и H4 доставляются к ДНК с помощью фактора сборки хроматина CAF-I (chromatin assembly factor I), состоящего из трех субъединиц с молекулярными массами 150, 60 и 50 кДа. Вновь синтезируемые гистоны H3 и H4 связываются первыми двумя субъединицами, из которых полипептид с молекулярной массой 150 кДа обладает сильно заряженным доменом, а другой содержит в своем составе WD-повтор (где W и D – аминокислоты Trp и Asn в соответствии с однобуквенным обозначением). На втором этапе к строящимся нуклеосомам добавляются гистоны H2A и H2B, что завершает формирование кóровых частиц нуклеосом. Исследования in vitro показали, что тетрамеры H3/H4 не исключают взаимодействия факторов транскрипции с соответствующими участками ДНК, как это делают зрелые нуклеосомы. С другой стороны, нуклеоплазмин, связывающий димеры H2A/H2B, стимулирует взаимодействие различных факторов с нуклеосомами (например GAL4, USF или Sp1). Кроме того, незрелый хроматин характеризуется пониженным содержанием линкерного гистона H1, присутствие которого стабилизирует нуклеосомы и структуры хроматина высшего порядка.

Конкурентные отношения между активацией транскрипции и созреванием хроматина во время клеточного цикла были продемонстрированы in vivo для дрожжевых генов, локализованных вблизи теломерных участков хромосом. У таких генов может иметь место мозаичный эффект положения (см. раздел 3.2.4). Например, транслокация гена Ura3 в область теломеры часто подавляет его транскрипцию, которая может быть возобновлена под действием белка-трансактиватора транскрипции Ppr1, но только в фазе G2/M клеточного цикла. Именно в это время происходит полное созревание вновь образуемого хроматина у большинства эукариотических организмов. Однажды установившись, активированное или репрессированное состояние гена вблизи теломерных участков хромосом поддерживается на протяжении многих клеточных делений. Эти эксперименты показывают, что во время сборки хроматина имеется возможность перепрограммирования компетентности генов в отношении транскрипции и регуляторная структура хроматина является наследуемой в ряду клеточных поколений.

Промоторы, активируемые через разрушение нуклеосомной структуры непосредственно факторами транскрипции, характерны для генов теплового шока дрозофилы. В поддержании открытой структуры ДНК в этом случае участвуют основные факторы транскрипции, а также GAGA-фактор, которые взаимодействуют с промотором в окрестностях TATA-бокса и точки инициации транскрипции. Такое взаимодействие обеспечивает открытое состояние вышерасположенного регуляторного элемента теплового шока. При индуцированном механизме разрушения нуклеосомной структуры ДНК в окрестностях промотора перед активацией гена нуклеосомы присутствуют как в вышерасположенных регуляторных последовательностях ДНК, так и в самом промоторе. Во время индукции транскрипции такого гена регуляторные факторы, связываясь с ДНК, прямо или косвенно вызывают разрушение нуклеосомной структуры соответствующих участков ДНК. Аналогичная стратегия активации промоторов реализуется также и в генах, регулируемых глюкокортикоидами. Для активации промоторов, структурированных в нуклеосомы, требуется несколько этапов. Вначале регуляторные факторы, структура которых более подробно обсуждается в разделе 3.2.2, взаимодействуют своими ДНК-связывающими доменами с соответствующей регуляторной последовательностью, расположенной выше промотора, что сопровождается вытеснением части или всех гистонов нуклеосом этой последовательности. Активирующие домены белковых факторов транскрипции далее индуцируют освобождение гистонов с основного промотора, что сопровождается образованием инициационного комплекса с участием РНК-полимеразы и основных факторов транскрипции. Сборка транскрипционного комплекса приводит к вытеснению еще одной порции гистонов с промотора.

Модификация структуры нуклеосом через ацетилирование гистонов. Рассмотренный пример показывает, что не только ДНК-связывающие домены факторов транскрипции адаптируют структуру хроматина для нужд синтеза РНК, но и их активирующие домены участвуют в разрушении структуры нуклеосом, расположенных на ДНК вблизи мест связывания факторов. Активирующие домены таких факторов взаимодействуют не только с основными факторами транскрипции, такими как TFIID, но и с коактиваторами транскрипции, которые не входят в состав основного транскрипционного комплекса, хотя и обеспечивают его функциональную связь с удаленными регуляторными последовательностями энхансеров и сайленсеров (подробнее см. раздел 3.2.2). До недавнего времени оставалось совершенно непонятным, каким образом активирующие домены факторов транскрипции могут оказывать влияние на структуру близлежащего хроматина. Этот вопрос начал проясняться после недавнего клонирования генов ядерных и цитоплазматических ацетилаз гистонов (HAT – histone acetyltransferase) и изучения свойств этих ферментов в очищенном состоянии.

Ацетилирование гистонов происходит на посттрансляционном уровне по специфическим остаткам Lys в N-концевых частях их полипептидных цепей, которые расположены на поверхности нуклеосомных частиц (см. табл. I.2). Эта посттрансляционная модификация уменьшает суммарный положительный заряд кóровых частиц нуклеосом и ослабляет взаимодействие плеч гистонов с ДНК. Хотя при этом сохраняется общая структурная целостность нуклеосом, их конформация может изменяться, что ингибирует in vitro зависимое от ионной силы образование структур хроматина более высокого порядка, связанное с подавлением транскрипции. Кроме того, ацетилирование гистонов нарушает специфические взаимодействия между их плечами и некоторыми регуляторными белками-репрессорами. В соответствии с этим, уже давно была обнаружена корреляция между повышенным уровнем ацетилирования гистонов и усилением транскрипции определенных участков генома, а пониженный уровень ацетилирования гистонов был связан с молчащими генами и гетерохроматином. Однако оставался непонятным механизм избирательного ацетилирования гистонов на промоторах активируемых генов.

Ацетилазы гистонов эукариот разделяют на две основные группы – HAT A и HAT B. Для ацетилаз HAT A характерна ядерная локализация. Эта группа ферментов участвует в посттрансляционном ацетилировании гистонов кóровых частиц нуклеосом и оказывает прямое влияние на транскрипцию. Цитоплазматические ацетилазы HAT B преимущественно модифицируют молекулы гистонов, находящиеся в свободном состоянии, и участвуют в их доставке к реплицируемой ДНК. Для этих двух систем ацетилирования характерна разная субстратная специфичность. Если ацетилазы HAT A ацетилируют все четыре гистона кóровых частиц нуклеосом, то ацетилазы HAT B модифицируют, прежде всего, гистоны H3 и H4 по другим остаткам Lys.

Дрожжевая цитоплазматическая ацетилаза гистонов типа В, кодируемая геном HAT1, по-видимому, обеспечивает направленную доставку вновь синтезированных гистонов в ядра, где характер их ацетилирования может быть изменен ядерной ацетилазой HAT A. Последовательность нуклеотидов клонированного гена ацетилазы HAT A Tetrahymena неожиданно оказалась высокогомологичной последовательности гена известного коактиватора транскрипции дрожжей GCN5, продукт которого (Gcn5), как выяснилось, также обладает активностью ацетилазы гистонов. Эта находка явилась первым указанием на то, что ацетилирование гистонов может быть одной из причин, а не следствием активации генов. Белок Gcn5 образует тримерный комплекс с двумя другими белками – Ada2 и Ada3, которые необходимы для активации генов кислыми факторами транскрипции Gal4–Vр16 и Gen4. При этом комплекс Gcn5–Ada2–Ada3 образует прямые контакты и с транс-действующими, и с основными факторами транскрипции в составе транскрипционного комплекса. Это позволяет объяснить механизм направленной доставки ацетилазы гистонов к активируемому промотору соответствующими специфическими белок-белковыми взаимодействиями. Интересной находкой этой серии экспериментов явилось понимание двойной роли комплекса Gcn5–Ada в активации транскрипции. Во-первых, он ацетилирует гистоны нуклеосом промотора, что повышает его доступность для основных факторов транскрипции и других регуляторных белков. Во-вторых, он непосредственно контактирует с этими факторами, облегчая образование прединициационного комплекса и стабилизируя его.

Таким образом, индивидуальные факторы транскрипции могут выполнять несколько разных функций в регуляции синтеза РНК, определяемых их выраженной доменной структурой. Как уже упоминалось, для полипептидных цепей большинства факторов транскрипции характерно наличие, по крайней мере, ДНК-связывающего и активирующего доменов. Из вышеизложенного следует, что ДНК-связывающие домены этих белков могут непосредственно изменять структуру нуклеосом в окрестностях промоторов, а активирующие домены не только контактируют с основными факторами транскрипции и стабилизируют их связь с промоторами, но и ассоциированы с активностями, модифицирующими структуру хроматина, что необходимо для эффективной инициации транскрипции и освобождения промотора элонгирующим транскрипционным комплексом. И все эти активности у дрожжей присущи одному сравнительно небольшому белковому комплексу Gcn5–Ada.

Деацетилазы гистонов. Стационарный уровень ацетилирования гистонов хроматина поддерживается в результате координированного действия HAT и деацетилаз гистонов (histone deacetylase – Hd), наиболее изученными из которых являются деацетилазы гистонов дрожжей, дрозофилы и человека. Быстрая очистка деацетилаз достигается с помощью аффинной хроматографии, в которой используется в качестве лиганда иммобилизованный высокоаффинный ингибитор трапоксин. При этом деацетилазы гистонов дрожжей выделяются в виде двух высокомолекулярных комплексов - HdA (350 кДа) и HdB (600 кДа). HdA может деацетилировать все четыре гистона и сильно ингибируется трихостатином А, тогда как HdB в 10 раз менее чувствительна к действию этого ингибитора. Очищенная HdA содержит в своем составе четыре полипептида, два из которых с молекулярными массами 75 и 71 кДа кодируются генами HDA1 и HDA3 соответственно. Деацетилаза HdB содержит в своем составе белок Rpd3, функционирование которого, как это было показано генетическими методами, необходимо для достижения не только полного подавления, но и полной активации экспрессии большого числа генов. В состав деацетилазы HdA входит Rpd3-подобный белок; такие белки представлены у дрожжей целым семейством, насчитывающим, по крайней мере, четыре члена. Инактивация деацетилаз HdA и HdB с помощью делеций в соответствующих генах приводит к гиперацетилированию гистонов H3 и H4 in vivo.

Как уже упоминалось, гиперацетилирование гистонов, как правило, коррелирует с активацией транскрипции определенных генетических локусов. Однако повышенный уровень ацетилирования гистонов может сопровождаться подавлением экспрессии генов, локализованных в теломерных участках хромосом дрожжей. Аналогичную ситуацию наблюдали у дрозофилы: инактивация гомологичного гена деацетилазы приводила к усилению эффекта положения гена white, транслоцированного в область центромерного гетерохроматина. Эти странные эффекты могут быть связаны с нарушением специфичности ацетилирования гистонов в условиях их гиперацетилирования при инактивации генов деацетилаз. Действительно, для подавления транскрипции у дрожжей необходимо ацетилирование единственного аминокислотного остатка (Lys-12 в гистоне H4). Кроме того, те же гистоны, ацетилированные по тому же самому положению, были обнаружены в транскрипционно неактивном -гетерохроматине политенных хромосом дрозофилы.

Как и в случае ацетилаз гистонов, специфический характер действия деацетилаз обеспечивается путем образования комплексов с белками-репрессорами и корепрессорами, которые распознают конкретные последовательности ДНК и друг друга. Ядерные рецепторы тиреоидных гормонов особенно хорошо иллюстрируют функционирование такого механизма. В отсутствие лиганда они взаимодействуют с комплексом репрессор–деацетилаза, что приводит к подавлению транскрипции соответствующих генов, тогда как под действием гормона рецепторы приобретают способность образовывать комплекс с коактиватором транскрипции и ацетилазой и стимулировать синтез РНК.

Другие специализированные белки, изменяющие структуру хроматина. В дополнение к вышеупомянутым белкам в настоящее время выделены и охарактеризованы два других специфических белковых комплекса, обеспечивающих изменение структуры нуклеосом во время транскрипции. Комплекс Swi/Snf был впервые обнаружен в клетках дрожжей генетическими методами как позитивный регулятор транскрипции большого числа генов, экспрессия которых контролируется разными механизмами. Похожий по механизму действия комплекс NURF (nucleosome remodeling

 

Таблица I.6

Субъединичный состав и свойства белковых комплексов Swi/Snf и NURF

Фактор

Субъединицы

Общая

молекулярная масса,

кДа

Активность

Swi/Snf

Swi1

Swi2 (Snf2)

Swi3

Snf3

Snf5

Snf6

p78

p68

p50

p47

p25

2000

ДНК-зависимая АТРаза

NURF

215 кДа

140 кДа

55 кДа

38 кДа

500

АТРаза, зависимая от нуклеосом

 

factor) был выделен из эмбрионов дрозофилы (табл. I.6).

Оба комплекса состоят из нескольких субъединиц, обладают ATPазной активностью и оказывают влияние на контакты между гистонами и ДНК. Однако для этих комплексов характерно отсутствие общих компонентов, и они различаются по механизмам стимуляции ATPаз. Такие различия между комплексами позволяют предполагать, что они действуют на разные субстраты и могут функционировать независимо друг от друга.

Первые указания на то, что факторы Swi/Snf участвуют в изменении структуры хроматина, были получены генетическими методами. Индивидуальные мутации swi или SNF, ингибирующие экспрессию ряда генов, супрессировались мутациями, повышающими внутриклеточный уровень гистонов. Комплексы Swi/Snf, выделенные из клеток дрожжей и человека, содержали, по крайней мере, десять различных белков. Первые шесть компонентов, перечисленные в табл. I.6, были идентифицированы как продукты конкретных генов, тогда как другие (p78–p25) – только как полипептиды указанной молекулярной массы. Комплекс Swi/Snf стимулирует in vitro ATP-зависимое связывание нуклеосомами транс-действующих факторов транскрипции. Мутационные изменения консервативных участков гистонов H3 и H4, необходимых для формирования у них правильной пространственной структуры, делают транскрипцию независимой от фактора Swi/Snf in vivo.

Недавно комплекс Swi/Snf удалось выделить в составе холофермента РНК-полимеразы II, так что этот комплекс может оказаться неотъемлемой  частью транскрибирующего фермента и присутствовать в инициационных комплексах всех промоторов. Однако в таком случае остается не совсем понятным, почему мутации в генах SWI/SNF оказывают влияние на экспрессию лишь некоторых генов. Поскольку белки Swi/Snf ассоциированы с медиаторным комплексом, который, в свою очередь, связан с CTD-доменом РНК-полимеразы II и обеспечивает ответ РНК-полимеразы на действие регуляторных факторов, последние могут по-разному реагировать на присутствие в комплексе мутантных белков Swi/Snf, что и может быть причиной дифференциального ответа конкретных промоторов на мутации.

Белковый комплекс NURF впервые был описан как кофактор уже упоминавшегося выше фактора транскрипции GAGA, который необходим для активации промотора гена теплового шока дрозофилы hsp70. In vivo в этом промоторе была обнаружена последовательность длиной в 200–300 нуклеотидов с повышенной чувствительностью к ДНКазе, в состав которой входят TATA-бокс и сайты связывания факторов GAGA и HSF (heat shock factor – фактор теплового шока). Гиперчувствительность промотора к действию ДНКазы можно было моделировать в бесклеточных экстрактах как до, так и после сборки хроматина путем добавления GAGA-фактора и ATP. Поскольку фактор GAGA сам по себе не обладает ATPазной активностью, в результате очистки белков с этой активностью и был идентифицирован комплекс NURF. Этот комплекс может разрушать нуклеосомы или изменять их положение в промоторе гена HSP70 и в отсутствие фактора GAGA. Однако присутствие NURF стимулирует связывание этого фактора со своим сайтом на промоторе, что, в свою очередь, ускоряет перестройку нуклеосом в этом участке гена. ATPазная активность NURF не стимулируется свободной ДНК или гистонами, однако усиливается в присутствии интактных нуклеосом, что отличает этот фермент от ATPазы Swi2. При микросеквенировании пептида с молекулярной массой 140 кДа в нем был обнаружен ATPазный домен, гомологичный таковому Swi2, однако это оказалось единственной гомологией между двумя комплексами. Следует еще раз подчеркнуть, что отсутствие у них общих субъединиц и существенной гомологии указывает на возможность независимого функционирования этих комплексов и действия на разные субстраты.

Специфичность функционирования ATP-зависимых белковых комплексов, изменяющих структуру нуклеосом, предполагает их точную доставку в нужные места хроматина. Как и в уже рассмотренном случае ацетилаз и деацетилаз гистонов, специфический характер взаимодействия комплексов с ДНК обеспечивается дополнительными белками. Выше упоминалось о том , что комплекс Swi/Snf входит в состав холофермента РНК-полимеразы II, что обеспечивает его доставку к соответствующим промоторным последовательностям. Кроме того, было показано, что этот комплекс может взаимодействовать с рецептором глюкокортикоидов и в таком виде оказывать влияние на структуру нуклеосом. Формирование таких комплексов, по-видимому, является одним из существенных моментов активации рецепторов глюкокортикоидов. Учитывая обсуждавшееся выше взаимодействие рецепторов стероидных гормонов с ацетилазами/деацетилазами гистонов, можно полагать, что специфическое изменение структуры хроматина является общим механизмом, посредством которого рецепторы оказывают влияние на экспрессию соответствующих генов.

Нуклеосомы при элонгации синтезируемой РНК. Механизмы, обеспечивающие элонгацию транскрипции на нативном хроматине, не совсем понятны. Поскольку РНК-полимеразы прокариот, в частности фагов SP6 и T7, обладают способностью транскрибировать хроматин in vitro, создавалось впечатление, что для прохождения РНК-полимеразами нуклеосом хроматина во время элонгации РНК не требуются дополнительные факторы. Тем не менее, нуклеосомы ингибируют транскрипцию хроматина in vitro на стадии элонгации эукариотическими РНК-полимеразами II и III, что не наблюдается in vivo. Одной из гипотез, объясняющих процесс элонгации транскрипции на хроматине, является модель двойных суперскрученных доменов. В соответствии с этой моделью предполагается, что транскрибирующая РНК-полимераза индуцирует в ДНК образование локальных суперскрученных доменов. Положительные супервитки образуются впереди элонгирующей РНК-полимеразы, а отрицательные – позади фермента. Закручивание ДНК вокруг гистонового октамера в нуклеосоме приводит к незначительным изменениям в параметрах двойной спирали ДНК и к образованию одного отрицательного супервитка в молекуле ДНК. Его формирование должно приводить к компенсаторной положительной сверхспирализации участков ДНК, прилегающих к нуклеосоме. Образование нуклеосом осуществляется предпочтительно на отрицательно сверхспирализованной ДНК, а ее положительная сверхспирализация сопровождается ослаблением структуры нуклеосом или их разрушением в присутствии дополнительных белковых факторов. Эти факты и лежат в основе обсуждаемой модели.

Таким образом, в соответствии с этой моделью, элонгирующая РНК-полимераза индуцирует впереди себя локальную положительную сверхспирализацию молекулы ДНК, что облегчает разрушение нуклеосом, находящихся в этой зоне. Повторное образование нуклеосом происходит в зоне отрицательно сверхспирализованной ДНК позади транскрибирующей РНК-полимеразы.

Конвергентный характер исследований функциональной структуры хроматина и транскрипции лишь иллюстрирует общую тенденцию развития современной молекулярной биологии и генетики. Чем глубже становится понимание механизмов функционирования отдельных генетических систем клетки, тем яснее видится их взаимозависимость и полифункциональность. Высокоупорядоченные перестройки нуклеосом и хроматина сопровождают не только транскрипцию, но и репликацию, рекомбинацию и репарацию повреждений ДНК. В связи с этим проблема структуры хроматина и динамики ее изменений в клеточном цикле является одной из центральных в современной молекулярной генетике.

Концепция транскриптосомы. Как было показано выше, транскрипционный комплекс, в состав которого входит эукариотическая РНК-полимераза II, устроен весьма сложно. Появляется все больше данных в пользу того, что транскрипционный комплекс взаимодействует с другими крупными белковыми комплексами, участвующими, в частности, в разрушении нуклеосом и репарации ДНК. Полный размер образующегося при этом стабильного транскрипционного комплекса, содержащего более 70 полипептидов, приближается к размеру рибосомы. Такой колоссальный размер транскрипционного комплекса эукариот, вероятно, должен замедлять поиск путем линейной диффузии регуляторных последовательностей нуклеотидов транскрибируемой ДНК, на которых происходит инициация транскрипции. Обсуждается возможность того, что инициация транскрипции у эукариот осуществляется в специализированных надмолекулярных комплексах, специфически ассоциированных с ядерным матриксом, которые получили название транскриптосом. По крайней мере, один из белковых компонентов, входящих в состав холофермента POL II животных, YY1, оказался идентичным фактору NMP-1, ассоциированному с ядерным матриксом. Возможно, именно с участием этого белка происходит прикрепление транскриптосом к ядерным мембранам.

Подводя итог рассмотрению основных этапов транскрипции, необходимо отметить, что инициация синтеза РНК, элонгация транскриптов и терминация транскрипции являются очень сложно организованными процессами. Структуры матричной ДНК и растущих цепей РНК оказывают влияние на процесс освобождения промотора РНК-полимеразами, а также на свойства самих элонгирующих и терминирующих ферментов. При этом на инициацию, задержку и прекращение транскрипции, расщепление РНК и ее реитеративный синтез, а также на саму терминацию оказывают действие многочисленные белковые факторы. Все это находит свое выражение в сложности регуляторных процессов, обеспечивающих координированную экспрессию генов на уровне транскрипции. Основные биохимические механизмы, контролирующие эти процессы, будут рассмотрены в соответствующих разделах книги.

  1.  Котранскрипционные и посттранскрипционные модификации РНК

Транскрипция у любого организма является первым этапом реализации генетической информации – экспрессии генов. Однако первичные транскрипты, как правило, представляют собой лишь предшественники зрелых мРНК – пре-мРНК, которые перед выполнением своих функций должны претерпеть многочисленные изменения, называемые посттранскрипционными модификациями. Кроме того, у эукариот зрелые мРНК должны быть доставлены от места их биосинтеза (ядра) к месту трансляции (цитоплазматическим рибосомам), т.е. экспортироваться из ядра в цитоплазму.

Одной из наиболее удивительных посттранскрипционных модификаций пре-мРНК является редактирование их первичной структуры. В результате посттранскрипционно изменяется смысл генетической информации, заключенной в соответствующем гене.

Посттранскрипционные модификации РНК особенно характерны для эукариотических организмов, у которых в силу мозаичной интрон-экзонной структуры их генов первичные транскрипты представлены гигантскими предшественниками, включающими в себя последовательности как экзонов, так и интронов. 5’-Конец предшественника мРНК чаще всего подвергается котранскрипционным модификациям, в результате которых к его 5’-концевому нуклеотиду особым образом присоединяется остаток гуанозина с образованием "шапочки" – кэпа. Эта котранскрипционная модификация создает условия для прохождения следующего этапа процессинга мРНК – сплайсинга, сопровождающегося вырезанием последовательностей интронов и объединением экзонов с образованием непрерывной кодирующей последовательности мРНК. Одновременно от 3’-конца путем эндонуклеазного расщепления отделяется избыточный фрагмент РНК, и к оставшейся части присоединяется поли(А)-последовательность. Эта совокупность реакций получила название полиаденилирования мРНК. После таких котранскрипционных и посттранскрипционных модификаций пре-мРНК образовавшаяся зрелая, стабилизированная мРНК переносится из ядра в цитоплазму, часто к специфическому месту своей внутриклеточной локализации, где может быть депонирована или эффективно транслироваться рибосомами. Каждый из этапов посттранскрипционных модификаций может использоваться для регуляции уровня экспрессии соответствующих генов.

  1.  Процессинг РНК у бактерий

мРНК прокариот обычно являются полицистронными, т.е. включают в себя последовательности нуклеотидов нескольких генов одного оперона (рис. I.10,а). Полицистронные мРНК бактерий при выполнении своих функций матричных РНК в трансляции не требуют разбиения на последовательности отдельных генов и могут транслироваться непосредственно рибосомами с образованием функционально активных белков. Исключением из правила являются полицистронные ранние мРНК нечетных T-бактериофагов Т3 и Т7, которые после транскрипции in vivo расщепляются до моноцистронных под действием РНКазы III, специфически гидролизующей двухцепочечные РНК. Участие этого фермента в процессинге указывает на наличие характерной вторичной структуры РНК на границах транскриптов отдельных генов вышеупомянутых бактериофагов, что и было обнаружено после определения их первичной структуры.

РНКаза III участвует также в процессинге предшественников рРНК у E. coli, поскольку 5S, 16S и 23S рРНК исходно синтезируются в составе общего первичного транскрипта. При этом в спейсерных участках 30S предшественников между последовательностями 16S и 23S рРНК расположены тРНК. Кроме того, у бактерий обнаружены транскрипты генов тРНК, содержащие до шести тРНК в составе одного предшественника. В процессинге предшественников тРНК у бактерий ключевую роль играет РНКаза P. Для проявления нуклеазной активности у этого необычного фермента требуется присутствие небольшой РНК, прочно ассоциированной с его полипептидной цепью. Именно ей присуща собственная эндонуклеазная активность, что характерно и для других рибозимов (подробнее см. главу 9). Таким образом, зрелые молекулы рРНК и тРНК образуются в клетках как прокариот, так и эукариот в результате серии эндо- и экзонуклеазных воздействий на их предшественники. Основной же посттранскрипционной модификацией является полиаденилирование их 3’-концевых последовательностей.

Полиаденилирование РНК у бактерий. Хотя поли(А)-полимераза E. coli, осуществляющая безматричный синтез поли(А) при наличии РНК-затравок, была очищена в 1962 г., поли(А)-РНК у бактерий не была обнаружена до 1975 г. и долгое время после этого рассматривалась как исключение из общего правила и биологический курьез. В настоящее время стало ясно, что полиаденилирование РНК у бактерий столь же обычно, как и у эукариот, и выполняет важные биологические функции. Поли(А)-последовательности бактериальных мРНК значительно короче соответствующих эукариотических. Их длина, в среднем, составляет всего 14–16 нуклеотидов (80–200 – у эукариот), а полиаденилированы лишь от 1 до 40% молекул мРНК каждого определенного вида в клетке (100% в случае эукариот). Более подробное сравнение свойств поли(А)-последовательностей прокариот и эукариот проведено в разделе 2.2.3.

Классы поли(А)-содержащих РНК бактерий. В зависимости от расположения сайта присоединения поли(А)-последовательности все бактериальные РНК разделяют на шесть классов (см. рис. I.10,а). В РНК первого класса происходит полиаденилирование 3’-концевого нуклеотида, следующего сразу за терминаторной шпилькой -независимого терминатора последней кодирующей области. У РНК второго класса терминаторная шпилька отщепляется посттранскрипционно РНКазой Е, и к образующемуся 3’-концу присоединяется поли(А). Терминаторная шпилька отсутствует и у полиаденилированных мРНК третьего класса, образующихся с участием -зависимых терминаторов транскрипции, благодаря особенностям структуры таких терминаторов. В укороченных мРНК четвертого класса отсутствует 3’-концевая кодирующая область, а поли(А) начинается непосредственно за межцистронной терминаторной шпилькой. В РНК пятого класса поли(А)-последовательности локализуются на концах укороченных цистронов, а у РНК шестого класса – на концах 5’-концевых некодирующих последовательностей. На основании структуры поли(А)+-мРНК делается вывод, что полиаденилирование у бактерий не зависит от присутствия в РНК специфических регуляторных сигналов, как это имеет место у эукариот, а определяется наличием у них свободных 3’-OH-групп. Такие промежуточные мРНК разной длины, по-видимому, появляются в результате деградации или преждевременной терминации синтеза полноразмерных транскриптов.

Поли(А)-полимеразы. Полиаденилирование бактериальных мРНК катализирует поли(А)-полимераза (ATP:полирибонуклеотид-аденилилтрансфераза), которая осуществляет независимое от матрицы последовательное присоединение остатков аденилата к 3’-OH-концам молекул РНК в соответствии со следующей реакцией:

РНК + nATP РНК(А)n + nPPi

У E. coli описаны две поли(А)-полимеразы. Поли(А)-полимераза I кодируется локусом pcnB, первоначально идентифицированным в качестве контролирующего число копий плазмид в бактериальных клетках. Процессированная молекула представляет собой полипептид с молекулярной массой 52 кДа, не обладающий гомологией с соответствующими эукариотическими ферментами, однако содержащий сегмент, гомологичный части полипептидной цепи тРНК-нуклеотидилтрансферазы, которая осуществляет посттранскрипционное присоединение акцепторного CCA-тринуклеотида к молекулам тРНК. Даже умеренная сверхэкспрессия рекомбинантного гена pcnB летальна для E. coli. Полная инактивация гена pcnB с помощью делеций не сопровождается прекращением полиаденилирования мРНК, что указывает на присутствие в геноме E. coli второго аналогичного гена. Такой ген был обнаружен в виде открытой рамки считывания f310, кодирующей полипептид с молекулярной массой 36,3 кДа, обогащенный гидрофобными аминокислотами. Полипептид не обладает гомологией ни с одной из известных бактериальных, вирусных или эукариотических поли(А)-полимераз.

Возможная функциональная роль полиаденилирования РНК у бактерий. Несмотря на то что полиаденилирование РНК интенсивно исследуется более 25 лет, его функциональная роль даже у эукариот полностью не выяснена. Еще меньше известно о роли полиаденилирования РНК у бактерий. Однако из имеющихся данных становится ясно, что влияние полиаденилирования РНК на молекулярные процессы бактериальной клетки весьма разнообразно и распространяется, по крайней мере, на контроль числа копий бактериальных плазмид, стабильность мРНК и ее трансляцию.

Регуляция репликации плазмид через полиаденилирование антисмысловых РНК. Более подробно механизмы регуляции репликации бактериальных плазмид будут рассмотрены в разделе 4.2.2 на примере плазмиды ColE1. Здесь же лишь кратко отметим, что у некоторых групп плазмид, например ColE1 или pBR322, которая является ее производной, регуляция числа копий осуществляется с помощью антисмысловой РНК (РНК I), образующей гибрид с РНК-праймером (РНК II), необходимым для инициации их репликации, и блокирует его функционирование. В соответствии с этим внутриклеточная концентрация РНК I является критическим параметром в регуляции репликации плазмид. Деградация РНК I инициируется отщеплением 5’-концевого пентануклеотида под действием РНКазы Е (РНК I–5) и далее контролируется поли(А)-полимеразой – продуктом гена pcnB. Полиаденилированная РНК I–5 обладает коротким временем полужизни, типичным для бактериальных мРНК (1–2 мин), тогда как немодифицированная РНК I–5 значительно более стабильна (время полужизни – >10 мин). Ускоренная деградация поли(А)-РНК I–5 инициируется полинуклеотидфосфорилазой. У поли(А)--РНК I–5 3’-концевой нуклеотид находится в составе шпильки, что препятствует эффективному действию полинуклеотидфосфорилазы. Однако при наличии короткого поли(А)-хвоста, выступающего за пределы шпильки, РНК I–5 эффективно расщепляется ферментом по 3’-экзонуклеазному механизму. В разрушение поли(А)+-РНК I–5 вносят свой вклад и другие нуклеазы, включая РНКазу Е и РНКазу III. Имеются данные и том, что полиаденилирование само по себе инактивирует РНК I–5, так как оно приводит к характерному изменению ее вторичной структуры.

Влияние полиаденилирования на время полужизни бактериальных мРНК. Описанное выше дестабилизирующее действие полиаденилирования на антисмысловые РНК распространяется и на некоторые бактериальные мРНК. Например, инактивация гена pcnB, кодирующего поли(А)-полимеразу, с помощью делеций сопровождается значительным увеличением времени полужизни мРНК генов lpp, trxA, ompA, а также rpsO на фоне мутаций pnp, rnb и rne, инактивирующих гены полинуклеотидфосфорилазы и соответствующих рибонуклеаз. Поскольку эти результаты были получены в отсутствие РНКазы Е, 3’-концы большинства бактериальных мРНК содержали шпильку, характерную для -независимых терминаторов транскрипции (см. рис. I.10). Экзонуклеазное расщепление РНК под действием полинуклеотидфосфорилазы и РНКазы II затруднено при наличии такой шпильки и облегчается в присутствии выступающей поли(А)-последовательности (см. рис. I.10,б). Как показано на рисунке, первичный транскрипт в бактериальных клетках может или полиаденилироваться, или подвергнуться экзонуклеазному расщеплению, неэффективному без поли(А)-последовательности, при наличии которой в процесс деградации активно включаются полинуклеотидфосфорилаза и РНКаза II. РНКаза Е может отщеплять как полиаденилированную, так и неполиаденилированную шпильку. Такой незащищенный с 3’-конца транскрипт подвергается атаке 3’-экзонуклеаз, с которой конкурирует полиаденилирование, препятствующее деградации мРНК по этому механизму. Следовательно, полиаденилирование мРНК в бактериальных клетках может выполнять альтернативные функции: дестабилизировать транскрипты при наличии у них 3’-концевых шпилек и стабилизировать "линейные" формы мРНК. Предполагается участие в деградации поли(А)+-мРНК и неизвестной РНКазы Х, поскольку этот процесс может происходить на фоне неактивных полинуклеотидфосфорилазы, РНКазы II и РНКазы Е.

Изображенная на рис. I.10 схема катаболизма первичных бактериальных транскриптов является упрощением, так как предполагает независимое действие нуклеаз. В последнее время, в соответствии с общей тенденцией, накапливаются данные о координированной работе большинства компонентов системы деградации бактериальных РНК в составе сложных мультиферментных комплексов, получивших название деградосом. Полное расщепление РНК с 3’-концевой шпилькой деградосомами требует расхода ATP ATP-зависимой РНК-хеликазой, а также участия белка DnaK, белков теплового шока, энолазы и гликолитического фермента с неизвестной функцией в метаболизме РНК.

Возможная роль полиаденилирования бактериальных мРНК в трансляции. Как будет видно из дальнейшего изложения (см. раздел 2.2.3), поли(А)-последовательности эукариотических РНК постоянно ассоциированы с жизненно важным поли(А)-связывающим белком PAB, который участвует как в регуляции стабильности мРНК, так и их трансляции. Поиск белка с аналогичными функциями у бактерий привел к очистке рибосомного белка S1, который кооперативно связывается с поли(А)-последовательностями мРНК с константой ассоциации 3·106 М–1. Функциональная роль этого взаимодействия в настоящее время не ясна, однако предполагают, что оно может оказывать влияние на трансляцию. Возможно, белок S1 облегчает доставку мРНК к 30S субчастицам рибосом, что должно стимулировать инициацию трансляции.

Полиаденилирование мРНК в митохондриях и хлоропластах. Концепция эндосимбиотического происхождения митохондрий и хлоропластов эукариот из бактерий-эндосимбионтов подкреплена многочисленными экспериментальными данными и является в настоящее время весьма популярной. В этой связи целесообразно рассмотреть особенности полиаденилирования РНК у этих органелл в данном разделе. Полиаденилированные мРНК митохондрий по своей структуре аналогичны мРНК E. coli класса IV (см. рис. I.10,а). Как и у бактерий, полиаденилирование митохондриальных РНК происходит вне зависимости от специфических регуляторных последовательностей, характерных для мРНК эукариот. Средний размер поли(А)-последовательностей мРНК митохондрий в клетках HeLa человека составляет 55 нт, а в клетках асцитных опухолей мышей – 35–55 нт, что соответствует длине поли(А)-последовательностей у бактерий. Поли(А)-полимераза митохондрий клеток гепатомы Морриса обладает молекулярной массой 60 кДа. Она способна добавлять к РНК in vitro поли(А)-последовательности длиной до 600 нт, однако в изолированных митохондриях их размер составляет 20–23 нт. Фермент кодируется ядерным геном.

Длина 3’-концевых поли(А)-последовательностей РНК хлоропластов значительно превышает таковую РНК бактерий и достигает нескольких сотен нуклеотидов, что характерно для эукариотических поли(А)+-РНК. Эти последовательности не обязательно являются гомополимерами остатков аденозина, но могут состоять из кластеров А (75%), перемежающихся последовательностями G (24%), а также C и U (суммарное содержание – 5%), что напоминает свойства некодирующих, обогащенных поли(А) участков мРНК бактериофага Т7. Поли(А)-полимераза хлоропластов гороха (Pisum sativum) состоит из трех субъединиц, среди которых полипептид с молекулярной массой 43 кДа обладает антигенными детерминантами, общими с поли(А)-полимеразой дрожжей, а из двух других гликозилированных субъединиц лишь РНК-связывающий полипептид с молекулярной массой 105 кДа абсолютно необходим для функционирования фермента.

  1.  Редактирование пре-мРНК

Недавно появились сообщения о новых механизмах изменения кодирующего потенциала мРНК на посттранскрипционном уровне, названных редактированием РНК (editing). Оказалось, что в клетках многих организмов имеются ферментные системы, способные с высокой специфичностью изменять первичную структуру мРНК, что, в свою очередь, меняет их кодирующий потенциал и приводит к образованию новых функционально значимых белков. Одним из первых был описан механизм редактирования РНК для митохондрий внутриклеточных паразитов – жгутиковых трипаносомид: Crithidia fasciculata, Leishmania tarentolae и Tripanosoma brucei. Митохондриальная (мт) ДНК этих одноклеточных представлена 20–50 идентичными копиями катенанов кольцевых молекул (зацепленные друг за друга кольца в виде гирлянды), называемых максикольцами, которые являются функциональными аналогами мтДНК других эукариот. Кроме того, их митохондрии содержат несколько тысяч копий небольших молекул ДНК (миникольца), функциональное значение которых до недавнего времени оставалось неизвестным. В результате функционирования механизма редактирования мРНК в специфические участки митохондриальной мРНК встраиваются многочисленные остатки уридина (U), не кодируемые максикольцами митохондриального генома, тогда как другие остатки U, включенные в мРНК в результате транскрипции мтДНК, удаляются из транскриптов. При таком "редактировании" кодирующего потенциала мРНК могут быть изменены до нескольких сотен остатков U (табл. I.7), что приводит к образованию протяженных открытых рамок считывания (ОРС), кодирующих у жгутиковых высокогомологичные белки, а также новых кодонов инициации трансляции (AUG), которые отсутствуют у мРНК, не подвергнутых редактированию. Такие модификации мРНК могут создавать новые терминирующие кодоны (UAG и UAA), а также затрагивать 3’-концевые нетранслируемые последовательности мРНК и poly(A)-хвосты. Функциональное значение редактирования этих нетранслируемых последовательностей мРНК неизвестно. Они, как полагают, могут оказывать влияние на стабильность соответствующих мРНК и их содержание внутри клеток.

Выбор последовательностей нуклеотидов в мРНК, которые подвергаются редактированию у трипаносомид, по-видимому, осуществляется с участием небольших РНК-проводников (guide RNAs, gRNA), частично комплементарных редактируемым участкам мРНК и кодируемых миникольцами мтДНК. gРНК являются первичными транскриптами, так как содержат на 5’-концах нуклеозиддифосфаты или нуклеозидтрифосфаты. На их 3’-концах обнаруживают 15 некодируемых остатков U, которые добавляются посттранскрипционно 3’-концевой уридилилтрансферазой.

 

Таблица I.7

Различные способы редактирования мРНК

Объект

Модифицированные или добавленные нуклеотиды

Митохондрии трипаносом

AAUUUAUGUUGUCUUU

Митохондрии P. polycephalum

AUCUCUAAGGGUUUAACCGG

                                          

Сдвиг рамки              Сдвиг рамки

Парамиксовирусы (ген Р)

AUUAAAAAGGGGCACAC

                           

                  Сдвиг рамки

Митохондрии позвоночных

CAGUAAAAAAAAAAAAAA

         

СТОП-кодон

                      высших растений

UUUUUCAUUGUGGUUUAC

                                        

       Phe                          Tyr

Хлоропласты высших растений

AAUAAUAUGGCGAAACAU

                

Инициирующий кодон

Ионные каналы млекопитающих, регулируемые глутаматом

UUUAUGCGGCAAGGA

                 

                Arg

Ген аполипопротеина В млекопитающих

GAUAUAAUUUGAUCAGUAUA

            

СТОП-кодон

 

Шесть или более 5’-концевых нуклеотидов gРНК комплементарны последовательности редактируемой мРНК, непосредственно предшествующей блоку нуклеотидов, подвергаемых редактированию. Уже сейчас ясно, что gРНК не служат матрицей для встраивания модифицируемых нуклеотидов в процессе посттранскрипционного редактирования РНК. Обсуждается гипотетический механизм этого процесса, который, к сожалению, не объясняет полностью имеющиеся факты. В соответствии с гипотезой образующиеся ошибочно спаренные (некомплементарные) нуклеотиды в гибридах gРНК и редактируемой мРНК служат сигналами для расщепления мРНК с последующим добавлением по местам разрывов остатков U. При этом места комплементарного спаривания нуклеотидов в РНК–РНК-гибридах защищены от редактирования. Кроме того, предполагают, что редактирование мРНК происходит с участием сложных нуклеопротеидных комплексов – эдитосом, по аналогии со сплайсингом, где участие аналогичных  комплексов – сплайсом в настоящее время доказано.

Другой тип редактирования РНК характерен для митохондрий слизневиков P. polycephalum (см. табл. I.7). В этом случае отдельные остатки С встраиваются во множественные участки митохондриальных мРНК, что приводит к сдвигам рамок считывания. Механизм данного процесса неизвестен.

Своеобразно решают задачу изменения кодирующего потенциала своих мРНК парамиксовирусы, в частности вирусы кори и свинки. Во время транскрипции гена P, кодирующего белок, ассоциированный с полимеразой, РНК-полимераза совершает ошибки, что сопровождается вставками лишних остатков гуанозина (G) в мРНК и, как следствие, сдвигом рамок считывания при их трансляции.

В транскриптах митохондрий позвоночных животных в процессе полиаденилирования мРНК происходит создание бессмысленных кодонов UAA и UGA, приводящих к преждевременной терминации трансляции, что в конечном счете сопровождается появлением новых полипептидных цепей. Тот же самый механизм реализуется в ядрах позвоночных.

Другая группа механизмов редактирования мРНК основана на ферментативном взаимопревращении остатков нуклеотидов. Например, в большинстве митохондрий высших растений в результате дезаминирования происходит превращение остатков С в U. В меньшей степени для них характерен обратный процесс: UC. При этом изменяется смысл кодонов в мРНК и, как следствие, происходит замена соответствующих аминокислот в белках. В настоящее время еще не охарактеризованы ферментные системы, осуществляющие такие посттранкрипционные превращения нуклеотидов на уровне мРНК.

Отдельно следует упомянуть редактирование мРНК, происходящее в хлоропластах высших растений, в частности у кукурузы и табака. Оказалось, что предсказание последовательностей аминокислот в белках хлоропластов, сделанное на основании последовательностей нуклеотидов их генов, часто не соответствует действительности. Так, в гене rpl2 хлоропластов кукурузы и гене psbL хлоропластов табака находится кодон AСG в том месте, где ожидается расположение наиболее распространенного кодона инициации трансляции ATG. При созревании транскриптов этих генов происходит их посттранскрипционная модификация, сопровождаемая превращением СU.

Своеобразный механизм посттранскрипционного редактирования РНК описан для транскриптов генов, кодирующих ионные каналы мозга млекопитающих, которые участвуют в передаче сигналов в синапсах центральной нервной системы. Известно, что субъединицы двух близкородственных классов глутаматных рецепторов содержат в определенных сегментах своих полипептидных цепей, формирующих каналы, остатки глутамина или аргинина, что оказывает существенное влияние на функционирование этих каналов. Оказалось, что субъединицы обоих классов кодируются генами, у которых в соответствующем месте имеется только кодон для глутамина (СAG), хотя в кДНК, полученной с использованием мРНК указанных субъединиц в качестве матрицы, в этом месте обнаружен также и аргининовый кодон СGG.

Интересно, что мРНК одной из субъединиц рецептора, принадлежащей на основании аминокислотных последовательностей к одному определенному классу (называемому здесь класс 1), подвергаются редактированию на 100%, тогда как транскрипты трех других субъединиц того же класса вообще не изменяются, несмотря на 90–95%-ную гомологию 30-звенных последовательностей, окружающих редактируемый сайт. Транскрипты двух субъединиц, принадлежащих к другому классу, редактируются с эффективностью соответственно 40 и 80%. Таким образом, во всех этих случаях имеет место количественная регуляция эффективности редактирования мРНК рецепторов мозга, что необходимо для пропорционального внутриклеточного синтеза соответствующих субъединиц. Механизм такой своеобразной регуляции экспрессии генов в настоящее время, к сожалению, не известен. Предполагают, что эдитосомы могут узнавать характерные элементы вторичной структуры мРНК, по-разному подвергающиеся редактированию.

Широкая, может быть, даже более широкая, чем мы сейчас представляем себе, распространенность посттранскрипционного редактирования мРНК у живых организмов указывает на этот механизм как на один из обычных способов реализации генетической информации. Использование таких модификаций пре-мРНК функционирующими генетическими системами при экспрессии генов расширяет кодирующий потенциал генома и добавляет еще одну возможность регуляции их функционирования на посттранскрипционном уровне. В табл. I.8 суммированы данные об использовании редактирования мРНК у животных и некоторых их вирусов, которые наглядно демонстрируют распространенность этого явления у данной группы организмов.

В заключение рассмотрим еще один наиболее хорошо изученный пример редактирования мРНК аполипопротеина B (ApoB) млекопитающих, участвующего в транспорте холестерина и триглицеридов в крови. Уже давно у млекопитающих обнаружили две формы ApoB, кодируемые одним и тем же геном и образующиеся в результате редактирования ApoB-мРНК (рис. I.11,а). Уникальный ген АpoB человека содержит 29 экзонов, и его общая длина составляет 43 т.п.о. Длина мРНК этого гена, кодирующей ApoB100 с молекулярной массой 512 кДа, составляет 14 тысяч оснований (т.о.). В середине самого большого экзона 26 имеется глутаминовый кодон СAA, который в результате редактирования мРНК превращается в терминирующий кодон UAA. Некоторые из мРНК, подвергшихся редактированию, расщепляются по криптическому (не функционирующему до расщепления) сайту   полиаденилирования,  что приводит к   образованию  более  короткой

 

Таблица I.8

Редактирование РНК у животных и их вирусов

Организм, ткань

Локализация

РНК-субстрат

Последствия редактирования

Печень/кишечник крыс

Ядро

APOB-мРНК

CU (CAAGluUAASTOP)

Мозг человека и грызунов

»

мРНК рецепторов AMPA и KA

AI (CAGGluCGGArg)

Семенники человека, нормальные и опухолевые ткани крыс

»

мРНК опухоли Вилмса 1

UA (CUCLeuCCCPro)

Мышцы человека

?

мРНК -галактозидазы

UA (TTCPheTACTyr)

Опухоли человека

Ядро

мРНК нейрофиброматоза типа 1

CU (CGAArgUGASTOP)

Печень крыс

»

тРНКAsp

CU и UC рядом с антикодоновой петлей

Сумчатые

Митохондрии

тРНКGly

CU в антикодоне (GlyAsp)

Вирус гепатита

Вирус

Антигеномная РНК

AI (UAGSTOPUGGTrp)

Парамиксовирусы

»

Ген Р

Вставки G

Вирус Эбола

»

Ген гликопротеина

Вставки А

 

мРНК длиной в семь т.о. В результате трансляции редактированных мРНК образуется укороченный ApoB48 (241 кДа), который содержит 2152 N-концевых аминокислотных остатка ApoB100. В функциональном отношении этот белок остается полностью активным, однако у него отсутствует С-концевой домен ApoB100, который отвечает за связывание с рецептором липопротеинов низкой плотности. Молекулярным механизмом редактирования ApoB-мРНК является сайт-специфическое дезаминирование цитозина с помощью цитидиндезаминазы. Недавно клонировали ген, кодирующий этот фермент у человека, и полностью определили его первичную структуру. Показано, что цитидиндезаминаза человека, осуществляющая редактирование ApoB-мРНК, представляет собой димер, построенный из двух идентичных субъединиц (АРОВЕС1) с молекулярной массой 28 кДа. Ген фермента, расположенный на хромосоме 12, экспрессируется исключительно в тонком кишечнике. Специфичность дезаминирования остатка цитозина определяется, по крайней мере, двумя факторами: последовательностью нуклеотидов мРНК в окрестностях этого сайта и белковыми кофакторами, взаимодействующими с каталитической субъединицей цитидиндезаминазы. Перенос методами генной инженерии последовательности нуклеотидов, фланкирующей сайт редактирования, в новые мРНК приводил к тому, что новые рекомбинантные РНК также подвергались специфическому редактированию in vivo и in vitro. В экспериментах такого рода, а также путем замен отдельных нуклеотидов методами направленного мутагенеза определили последовательность нуклеотидов мРНК, отвечающую за специфичность редактирования. Оказалось, что для оптимального осуществления этого процесса необходима последовательность длиной в 55 нуклеотидов, однако и 25 нуклеотидов в окрестностях сайта было достаточно, чтобы редактирование осуществлялось in vitro с 25%-ной эффективностью. Ниже представлены последовательности нуклеотидов в  окрестностях сайтов редактирования, которые оказались высокогомологичными у разных видов млекопитающих.


                         С→U       * * ** *  * * * *

Человек   Сайт 1   GAUA   С AAUU  UGAUСAGUAUAUUAAAG

         Сайт 2   aAaA   С AAUссaUGAUСuaсAUuUguuua

Бабуин    Сайт 1   GAUA   С AAUU  UGAUСAGUAUAUUAAAG

Свинья    Сайт 1   GAUA   С AAUU  UGAUСAGUAUAUUAAAG

Кролик    Сайт 1   GAUA   С AAUU  UGAUСAGUAUAUUAAAG

Крыса     Сайт 1   GAUA   С AAUU  UGAUСAGUAUAUUAgAG

Мышь      Сайт 1   GAUA   С AAUU  UGAUСAGUAUAUUAAAG

Звездочками обозначены нуклеотиды, замены которых с помощью направленного мутагенеза наиболее резко снижали эффективность редактирования, а строчными буквами отмечены негомологичные нуклеотиды. Подчеркнута последовательность нуклеотидов, получившая название якорной последовательности (mooring sequence). Эта последовательность является единственным цис-действующим регуляторным элементом, присутствие которого необходимо и достаточно для специфического редактирования вышерасположенного остатка С в экспериментах in vitro. Редактирование ApoB-мРНК здесь происходит после удаления из нее интронов в результате сплайсинга. Эффективность редактирования в таких системах зависит от нуклеотидных последовательностей в окрестностях этого сайта. В частности, АТ-богатые последовательности без выраженной вторичной структуры, фланкирующие якорную последовательность, стимулируют редактирование APOB-мРНК.

В связи с тем, что простая 11-звенная якорная последовательность определяет нуклеотид, который редактируется в этой системе, возникает вопрос о дополнительных факторах, которые требуются для обеспечения специфичности функционирования системы редактирования, зависимой от присутствия якорной последовательности. Действительно, перемещение якорной последовательности in vitro к любому остатку C на расстояние трех–четырех нуклеотидов от него в направлении 3’-конца РНК обеспечивает его редактирование in vivo. Предполагается, что в эдитосомах, осуществляющих редактирование ApoB-мРНК, соблюдается определенное соотношение между содержанием APOBEC1-субъединиц и дополнительных факторов-помощников (см. рис. I.11,б). В этой части рисунка показана гипотетическая структура нормальной эдитосомы, осуществляющей редактирование АРОВ-мРНК. Такая эдитосома включает собственно каталитический димер, два полипептида с молекулярными массами 66 и 44 кДа, необходимыми для специфического взаимодействия эдитосомы с якорной последовательностью, а также сопутствующие факторы Х, ассоциированные с белком AUX240 (240 кДа), который регулирует эффективность редактирования мРНК, обеспечивая сборку эдитосомы из белковых компонентов.

Сверхэкспрессия APOBEC1-субъединицы в клетках, достигаемая генно-инженерными методами, приводит к изменению специфичности редактирования. Это было объяснено нарушением стехиометрических соотношений между молекулами субъединиц и дополнительными факторами, обеспечивающими специфичность редактирования (см. рис. I.11,в). На рисунке показано, что избыток субъединицы АРОВЕС1 в эдитосоме стимулирует ее к редактированию вышерасположенных остатков С в АpoВ-мРНК, поскольку изменяется характер фолдинга 5’-концевой части редактируемой мРНК. В результате другие остатки С становятся доступными для каталитических субъединиц.

В соответствии с вышеизложенным, все известные в настоящее время формы редактирования пре-мРНК можно подразделить на два класса: инсерционное редактирование и редактирование с замещением. В первом случае редактирование мРНК сопровождается вставкой и/или удалением специфических нуклеотидов. Предполагается, что при такой форме редактирования последовательность нуклеотидов мРНК образует гибрид с gРНК, что сопровождается появлением неспаренных и ошибочно спаренных оснований, которые и маркируют сайты редактирования. Далее происходит расщепление углевод-фосфатного остова мРНК по этим сайтам в результате реакции трансэтерификации между фосфатными группами мРНК и встраиваемых нуклеотидов с последующим повторным лигированием образовавшихся фрагментов мРНК, сопровождаемым вставкой или удалением нуклеотидов. Такой механизм реализуется, по крайней мере, в митохондриях некоторых жгутиковых, а также слизневиков. У последних в результате редактирования митохондриальных мРНК имеют место вставки остатков С. Инсерционное редактирование мРНК парамиксовирусов, сопровождающееся вставками остатков G, по-видимому, происходит вследствие ошибок РНК-полимеразы при транскрипции соответствующих генов. В результате редактирования с замещением, как это имеет место в случае редактирования  ApoB-мРНК, а также, возможно, мРНК митохондрий и хлоропластов высших растений и ионных каналов, не происходит расщепления фосфодиэфирных связей в редактируемой РНК, а новое азотистое основание синтезируется in situ (т.е. модифицируется непосредственно в ее полинуклеотидной цепи). При этом не используется gРНК. Формально такой механизм напоминает реакции посттранскрипционной модификации азотистых оснований в тРНК, рРНК, малых ядерных РНК, а также двухцепочечных РНК.

Каково же биологическое значение механизма редактирования генетической информации на уровне мРНК? Какие силы заставили этот механизм эволюционно закрепиться у большого числа далеко отстоящих друг от друга биологических видов? Почему для организмов выгоднее изменять информацию посттранскрипционно, а не заключать ее непосредственно в генах? Очевидно, что для этого должны быть веские, не вполне понятные сегодня причины, которые не допускают перехода к обычному кодированию такой информации. На мой взгляд, редактирование мРНК может иметь непосредственное отношение к дополнительной стабилизации генетической информации в наиболее уязвимых для мутагенеза генетических локусах. Действительно, редактирование РНК получило наибольшее распространение в хлоропластах и митохондриях высших организмов, а также у одноклеточных эукариот. В разделе 5.3.1 приводится обоснование того, что дополнительная защита генетической информации от разрушительного действия химических мутагенов особенно нужна именно многоклеточным организмам для предотвращения накопления генетического груза в делящихся соматических клетках при онтогенезе. Вероятно, одним из путей достижения этого было эволюционное включение в геном эукариот избыточных последовательностей нуклеотидов. У свободноживущих одноклеточных организмов на популяционном уровне такой проблемы не существует, поскольку гибель отдельной свободноживущей клетки не грозит существованию популяции этих клеток, как это имеет место у Metazoa. Однако у митохондрий и хлоропластов, часто рассматриваемых в качестве внутриклеточных микроорганизмов-эндосимбионтов, наблюдаются совершенно особые условия существования. Несмотря на то что их геном содержит мало избыточных последовательностей и, следовательно, слабо защищен ими от химических мутагенов, мутации в определенных генах митохондрий и хлоропластов могут быть летальными для соматической клетки-хозяина и всего многоклеточного организма. В этих условиях мутационное изменение нуклеотидов, подвергающихся редактированию на уровне РНК, фактически заменяет само редактирование, и такие мутации нейтральны в функциональном отношении. В отсутствие мутаций редактирование корректирует первичную структуру РНК, а при наличии их необходимость в редактировании отпадает. Иными словами, во всех этих локусах редактирование как бы упреждает мутационные замены редактируемых нуклеотидов в генах, которые геном по каким-то причинам не может эффективно предотвратить в силу особенностей структуры и функционирования соответствующих генетических локусов. По аналогии с неоднозначностью генетического кода наличие механизма редактирования допускает сосуществование в конкретных генетических локусах "вырожденных сайтов", различающихся по первичной структуре, но не своему генетическому смыслу.

  1.  Другие модификации эукариотических мРНК

Посттранскрипционные модификации предшественников эукариотических мРНК по сравнению с теми же изменениями первичных транскриптов прокариот более разнообразны и играют большую роль в регуляции экспрессии их генов. Почти все эти реакции происходят в ядре эукариотических клеток в процессе синтеза РНК или сразу же после его завершения. Прежде всего, к 5’-концевому нуклеотиду большинства пре-мРНК присоединяются кэп-группы, что сопровождается метилированием одного или нескольких концевых нуклеотидов, в большинстве случаев необходимым для стабилизации и экспорта соответствующих мРНК из ядра в цитоплазму, а также их эффективной трансляции рибосомами. В основном те же функции, по-видимому, выполняет и полиаденилирование 3’-концевых последовательностей мРНК, которые подготавливаются к этому этапу путем специфического отщепления избыточных 3’-концевых нуклеотидов предшественника. Кроме того, интроны, содержащиеся в гигантских первичных предшественниках мРНК, с высокой точностью удаляются в результате сплайсинга. Ниже будут рассмотрены механизмы перечисленных посттранскрипционных модификаций пре-мРНК эукариот. Об использовании этих реакций в регуляции экспрессии генов на посттранскрипционном уровне речь пойдет в разделе 3.3.

Кэпирование. Сразу же после инициации транскрипции чаще всего происходит котранскрипционная модификация 5’-конца мРНК, сопровождаемая присоединением так называемой кэп-группы и дальнейшими ее изменениями. Кэпирование является одной из самых ранних модификаций растущих цепей РНК и происходит после полимеризации ее первых 20–30 нуклеотидов. Такая котранскрипционная модификация мРНК не только стабилизирует мРНК в цитоплазме, но и необходима в большинстве случаев для ее эффективной трансляции. Так, один из факторов инициации трансляции eIF-4E выполняет функции кэп-связывающего белка и требуется для осуществления кэп-зависимой трансляции мРНК. Кроме того, установлено, что кэпирование мРНК необходимо для эффективного сплайсинга пре-мРНК, ее полиаденилирования и экспорта из ядра в цитоплазму. Кэпированию подвергаются только транскрипты РНК-полимеразы II. На исключительную значимость реакций кэпирования указывает и тот факт, что контролирующие их гены являются жизненно важными.

Как уже упоминалось выше, транскрипция у эукариот и прокариот начинается, как правило, с пуринового рибонуклеозидтрифосфата – ATP, или GTP, причем трифосфатная группа сохраняется в составе мРНК. Таким образом, 5’-концевая последовательность мРНК в ядре на ранних этапах транскрипции представлена в следующем виде: ppp(A/G)pNpNpN... Гуанилилтрансфераза катализирует присоединение к растущей цепи мРНК молекулы GMP, которая оказывается связанной с 5’-концевым пурином 5’–5’-трифосфатной группой. Суммарная реакция первого этапа процесса кэпирования выглядит следующим образом:

G(5’)ppp + ppp(5’)(A/G)pNpNpN...

 Гуанилилтрансфераза

G(5’)ppp(5’)(A/G)pNpNpN... + pp + p

Реакция, по-видимому, протекает в две стадии. Вначале фермент связывает молекулу GTP (входящую затем в состав кэп-группы), что сопровождается отщеплением пирофосфата и образованием ковалентной связи фермент–GMP. Далее GMP присоединяется к 5’-концу мРНК, которая в результате теряет -фосфатную группу. В результате нуклеотид кэп-группы оказывается в обратной ориентации по отношению к остальным нуклеотидам мРНК. Процесс создания кэп-группы этой последовательностью реакций не заканчивается. На заключительных этапах кэпирования происходит метилирование по N7 ранее присоединенной молекулы гуанозина. Такие посттранскрипционные модификации происходят в несколько стадий в цитоплазме клеток после транспорта процессированной мРНК из ядра с участием цитоплазматических ферментов.

Первая стадия метилирования осуществляется ферментом РНК(гуанил-7)-метилтрансферазой, которая переносит метильную группу S-аденозилметионина в положение 7 концевого гуанина кэп-группы (рис. I.12). Кэп-группа, метилированная лишь по этому положению, характерна для одноклеточных эукариот и получила название кэпа 0-го типа. Вслед за этим у большинства многоклеточных эукариот происходит метилирование 2’-ОН рибозы 5’-концевого инициаторного нуклеотида (A или G), который является первым нуклеотидом, включаемым в мРНК при инициации ее синтеза РНК-полимеразой. Метилирование катализирует другой цитоплазматический фермент – 2’-О-метилтрансфераза. Такая основная форма кэпа большинства эукариот получила название кэпа 1-го типа. Очень редко и только у тех мРНК, инициация синтеза которых происходит с ATP, под действием 2’-О-метиладенозин-N6-трансферазы метилируются NH2-группы этого остатка А. Фермент распознает данную концевую группу в качестве субстрата лишь в том случае, если она была предварительно метилирована в положении 2’-OH в результате вышеописанной реакции.

У некоторых видов эукариот метильная группа может дополнительно присоединяться ко второму от кэп-нуклеотида нуклеозиду мРНК (см. рис. I.12). Субстратом для этого фермента служит мРНК с кэпом 1-го типа, уже содержащим две метильные группы. В результате происходит метилирование остатка рибозы по 2’-ОН-группе с образованием структуры, получившей название кэпа 2-го типа. Если эта реакция имеет место, то мРНК, содержащие кэп 2-го типа, составляют 10–15% от общей популяции молекул кэпированных мРНК.

Иная структура кэп-группы характерна для некоторых зрелых некодирующих РНК, в частности малых ядерных РНК, обогащенных урацилом (U-мяРНК). В этом случае остаток гуанозина кэп-группы дважды метилирован в положении 2 в дополнение к обычной метильной группе в положении 7: m2,2,7G(5')ppp(5')N. Такое гиперметилирование U-мяРНК требуется для импорта собранных U-мяРНП-частиц в ядро и, возможно, предотвращает вовлечение U-мяРНК в трансляцию.

Полиаденилирование. Одним из обязательных этапов созревания предшественников эукариотических мРНК, синтезированных в ядре, является процессинг их 3’-концевых последовательностей, тесно сопряженный с присоединением кэп-группы. Созревание 3'-конца мРНК является двухэтапным процессом. Вначале предшественник теряет 3’-концевую некодирующую последовательность, после чего, как правило, к 3’-концу присоединяется поли(А)-последовательность путем ферментативной полимеризации остатков AMP:

5’ GpppG__________AAUAAA__________UUUUU___ 3’

     Расщепление

5’ GpppG__________AAUAAA__OH  P____UUUUU___ 3’

     Полиаденилирование

5’ GpppG__________AAUAAA__AAAAAAAAAAAAAAA 3’

В настоящее время известно несколько исключений из этого правила: гистоновые мРНК животных и мРНК некоторых вирусов, предшественники которых расщепляются с помощью высокоспецифических эндонуклеаз и не полиаденилируются. Остаются неполиаденилированными и U-мяРНК, которые также являются транскриптами РНК-полимеразы II. В этом случае кэпированный первичный транскрипт мяРНК U1, содержащий на своем 3'-конце несколько избыточных нуклеотидов, экспортируется из ядра в цитоплазму, где и происходит удаление избыточной последовательности, которое в ядре блокировано специфическим белковым ингибитором TPI (3'-terminal processing inhibitor).

Места отщепления 3’-концевых некодирующих последовательностей в мРНК животных обычно маркированы специальными последовательностями нуклеотидов (рис. I.13). Имеются, по крайней мере, две такие последовательности, образующие сайты полиаденилирования, или поли(А)-сайты. Одна из них – AAUAAA расположена за 15 нуклеотидов перед расщепляемой фосфодиэфирной связью и практически одинакова у всех исследованных организмов. Другая, менее изученная последовательность располагается сразу же за первой и часто состоит из нескольких остатков U или обогащена GU. Сайт расщепления РНК определяется расстоянием между этими двумя элементами с предпочтительным расщеплением фосфодиэфирной связи на 3’-конце остатка A, находящегося на участке, в котором расщепление разрешено. Имеются данные о том, что последовательности, расположенные выше AAUAAA, могут оказывать стимулирующее влияние на процессинг, но их присутствие необязательно для его правильного осуществления.

С последовательностью AAUAAA взаимодействует фактор CPSF (cleavage and polyadenylation specificity factor), определяющий специфичность расщепления и полиаденилирования РНК. CPSF состоит из четырех субъединиц с молекулярными массами 160, 100, 70 и 30 кДа. Последняя из них, по-видимому, не является необходимой для его функционирования. Самая большая субъединица находится в непосредственном контакте с последовательностью AAUAAA.

С GU-богатой и ниже расположенной последовательностью связывается гетеродимерный белковый фактор CstF (cleavage stimulating factor), стимулирующий расщепление и состоящий из трех субъединиц (77, 64 и 50 кДа). Вторая субъединица контактирует с GU-богатым регуляторным элементом и обладает типичным РНК-связывающим доменом. По отдельности факторы CPSF и CstF лишь слабо взаимодействуют с РНК. Однако их одновременное присутствие приводит к образованию прочного комплекса. Такой кооперативный эффект и взаимодействие двух факторов между собой определяются их большими субъединицами.

В расщеплении РНК непосредственно участвуют еще два фактора: CFI и CFII (cleavage factors). Как и в предыдущем случае, лишь вместе они образуют прочный комплекс с РНК.

Для полного реконструирования бесклеточной системы, осуществляющей процессинг 3’-концов in vitro, в ней помимо вышеупомянутых факторов необходимо наличие поли(А)-полимеразы – фермента, непосредственно осуществляющего полиаденилирование. Присутствие этого фермента требуется не для самого акта расщепления РНК, а, по-видимому, для стабилизации процессирующего белкового комплекса, схематически изображенного на рис. I.13. Сборка такого сложного комплекса зависит от ATP, однако в процессе сборки не происходит расщепления ее -связей. В настоящее время неизвестно, какой именно компонент этого комплекса непосредственно расщепляет фосфодиэфирные связи РНК. Процесс полиаденилирования начинается сразу же за расщеплением РНК и происходит настолько быстро, что неполиаденилированных промежуточных продуктов не обнаруживается. Такое сопряжение двух реакций необходимо для защиты 3’-концевых последовательностей РНК от деградации нуклеазами. При этом сам акт полиаденилирования требует наличия только фактора CPSF, но не трех других: CstF, CFI и CFII.

Поли(A)-полимераза животных состоит из двух субъединиц с молекулярными массами   80 и  43 кДа, которые образуются в результате альтернативного сплайсинга их общей пре-мРНК. Короткий полипептид не обладает ферментативной активностью, и его функции неизвестны. Большая полипептидная цепь содержит С-концевой домен, обогащенный Ser и Thr и не определяющий ни одну из функций фермента, обнаруживаемых in vitro. Предполагают, что регуляторную роль играет множественное фосфорилирование этого домена. С-Концевой домен также содержит один из двух сигнальных последовательностей, необходимых для транспорта фермента в ядро. Вторая сигнальная аминокислотная последовательность локализована на границе С-концевого домена и основного полипептида поли(A)-полимеразы. Сравнительное исследование первичной структуры поли(А)-полимеразы показало наличие в ее полипептидной цепи каталитического домена, характерного для полимераз так называемого семейства X, к которому относятся ДНК-полимераза , терминальная трансфераза, а также некоторые другие нуклеотидилтрансферазы. Используя 3’-конец расщепленной РНК в качестве затравки, поли(А)-полимераза последовательно присоединяет к нему остатки AMP из ATP по тому же самому механизму, что и другие ДНК- и РНК-полимеразы. Для эффективного функционирования поли(A)-полимераза требует наличия фактора CPSF, а также поли(A)-связывающего белка PAB II (poly(A)-binding protein II), который связывает полиаденилирующий комплекс с РНК после присоединения к ней, по крайней мере, десяти остатков А. В присутствии этих двух факторов поли(А)-полимераза сразу синтезирует поли(А)-последовательность полной длины по процессивному механизму. Гипотетическая структура элонгирующего комплекса представлена на рис. I.14.

Процессивное (непрерывное) полиаденилирование 3’-концов РНК происходит со скоростью  25 нуклеотидов/с до тех пор, пока длина поли(А)-последовательности не достигнет  250 нуклеотидов. После этого процессивная реакция прекращается, и происходит медленное дистрибутивное присоединение остатков AMP разными молекулами поли(А)-полимеразы. Предполагают, что элонгирующий белковый комплекс узнает длину синтезированной поли(А)-последовательности при участии фактора PAB II (см. рис. I.14). По этому механизму связывание определенного числа молекул PAB II с поли(А) прекращает элонгацию поли(А)-последовательности. Такой строгий контроль за длиной поли(А) на 3’-концах процессированных мРНК имеет большое значение для действия механизма, контролирующего время полужизни мРНК в цитоплазме. Без тщательного контроля над этим процессом с помощью селективного деаденилирования невозможно регулировать внутриклеточную деградацию мРНК, а вместе с тем и уровень экспрессии соответствующих генов с участием данного механизма.

Полиаденилирование является универсальным феноменом, играющим важную роль в процессинге и функционировании мРНК как прокариотических, так и эукариотических организмов. Однако сравнение механизмов полиаденилирования у этих групп организмов выявляет существенные различия, суммированные в табл. I.9.

Н. Саркаром (1997 г.) было высказано предположение о возникновении механизма полиаденилирования РНК. Он полагает, что поскольку у бактериальных и эукариотических ферментов, выполняющих аналогичные функции, не обнаружено гомологии в аминокислотных последовательностях, оба фермента возникли недавно из уже значительно дивергировавших функционально родственных предшественников. Такими предшественниками могли быть прокариотические и эукариотические тРНК-нуклеотидилтрансферазы, осуществляющие посттранскрипционный синтез последовательности CCA на 3’-концах тРНК, что по своему механизму близко к полиаденилированию. Подтверждением этого является обнаруженная значительная гомология между тРНК-нуклеотидилтрансферазой и основной поли(А)-полимеразой E. coli, а также между тРНК-нуклеотидилтрансферазой бактерии Sulfolobus shibatae, обитающей в горячих серных источниках, и поли(А)-полимеразами эукариот. Следы такой эволюционной связи обнаруживаются и в современных митохондриях, где в результате полиаденилирования мРНК могут создаваться терминирующие кодоны. По мнению Саркара, различия между системами полиаденилирования прокариот и эукариот, представленные в табл. I.9, можно рассматривать в качестве продукта эволюционной дивергенции сходных биосинтетических функций в процессе независимого возникновения нового регуляторного механизма, обеспечивающего физиологические нужды уже глубоко различающихся групп организмов.

 

Таблица I.9

Сравнение полиаденилирования мРНК у эукариот и прокариот

Функции

Млекопитающие

E. coli

Длина поли(А)-последовательностей, нт

80–200

14–60

Уровень полиаденилирования отдельных мРНК, %

100

2–50

Локализация сайтов полиаденилирования

Ниже консенсусной последовательности AAUAAA

Любые доступные 3’-OH-концы мРНК

Функции:

стабильность мРНК

Стабилизация мРНК без участия 3’-концевых структур типа "стебель–петля"

Дестабилизация мРНК, обладающих 3’-концевыми структурами типа "стебель–петля", возможная стабилизация мРНК без таких структур

трансляция

Специфический контакт с белком PABP, необходимый для взаимодействия мРНК с 40S субчастицами рибосом

Связывание рибосомного белка S1, возможно, необходимое для взаимодействия мРНК с 30S субчастицами рибосом

репликация плазмид

Не участвует

Деградация антисмысловой РНК, ингибирующей репликацию плазмид типа ColE1

 

Сплайсинг. Мозаичная интрон-экзонная структура генов эукариот предполагает функционирование механизма, который бы распознавал интроны в предшественниках РНК и с высокой точностью удалял их. Действительно, в 1977 г. такой процесс был обнаружен, он получил название сплайсинга (от англ. splice – соединять концами) и с тех пор интенсивно исследуется.

Удаление последовательностей интронов с помощью сплайсинга происходит в ядрах эукариот сразу после завершения синтеза пре-РНК. В сплайсинге, как правило, участвуют особые рибонуклеопротеиновые (РНП)-частицы – малые ядерные РНП (мяРНП), в состав которых входят мяРНК U1–U6 и многочисленные белки. Эти РНП-частицы на стыках интронов и экзонов образуют функциональный комплекс, получивший название сплайсомы. Однако не все интроны для своего удаления требуют функционирования такого сложного аппарата. В частности, интроны предшественников тРНК у эукариот удаляются с участием более простого набора ферментов, а для вырезания некоторых интронов не требуется никаких дополнительных компонентов, кроме самих предшественников РНК. Последний процесс получил название аутосплайсинга (self-splicing). Поскольку механизмы химических реакций, происходящих в ходе аутосплайсинга, реализуются и при функционировании сплайсомы, они будут рассмотрены более подробно в следующем разделе.

В заключение этого краткого введения определим с помощью приведенной ниже схемы термины, которые будут использоваться при обсуждении механизмов сплайсинга.

5’-Концевой сайт                   Точка               3’-Концевой сайт

  сплайсинга                   разветвления          сплайсинга

                                                                    

5’–экзон 1GUAUGU__...__UACUAAC__...__(Py)nAGэкзон 2–3’

-----------------------Интрон---------------------

На схеме изображен интрон, соединяющий два соседних экзона в предшественнике мРНК дрожжей. В общих чертах та же структура характерна и для пре-мРНК высших организмов. Места соединения интронов и экзонов, в которых происходит разрыв фосфодиэфирных связей пре-мРНК во время сплайсинга, в зависимости от их положения в интроне называют 5’- или 3’-концевыми сайтами сплайсинга. Полипиримидиновая последовательность (Py)n перед 3'-концевым сайтом сплайсинга существенна для правильного вырезания интронов. Остаток аденозина в консервативной последовательности нуклеотидов интрона, расположенный ближе к его 3’-концу, получил название точки разветвления (branch point). Именно с этим аденозином ковалентно соединяется 5’-конец интрона, освобождающийся на первом этапе сплайсинга с образованием структуры типа "лассо" (lariat) (см. ниже). Первичная структура указанных сайтов мало консервативна в генах, кодирующих ядерные пре-мРНК, и может значительно варьировать даже у интронов одного и того же организма. В зависимости от механизма вырезания интронов и особенностей их пространственной структуры различают интроны групп I, II и III, интроны ядерных РНК, а также твинтроны – интроны, расположенные внутри интронов.

Аутосплайсинг интронов групп I, II и III. Открытие интронов, удаляющихся из пре-РНК в результате аутокаталитического процесса – аутосплайсинга, имело далеко идущие последствия для развития фундаментальных и прикладных исследований в молекулярной генетике и породило целое направление с использованием рибозимов (подробнее см. раздел 9.2). Такие интроны впервые были обнаружены в органеллах высших организмов, но вскоре было продемонстрировано их широкое распространение в природе. Исследование молекулярных механизмов аутосплайсинга показало, что хотя все вышеупомянутые интроны в сплайсинге используют одни и те же реакции трансэтерификации:

                                                         О                         О

                                                                                    

R–OH + R’–O–P–OR’’  R–O–P–OR’’ + R’–OH,

                                                                                    

                                                         О                          О

детали механизмов для интронов групп I, II и III различны.

На рис. I.15,а,б изображены структурные особенности интронов I–III групп. Интроны группы I образуют наиболее сложные вторичные и третичные структуры. Они обнаружены в предшественниках РНК простейшего Tetrahymena thermophila и удаляются из них с использованием приведенного в табл. I.10 механизма.

 

Таблица I.10

Механизм прямой и обратной реакций аутосплайсинга

интронов группы I

Аутосплайсинг

Обратное лигирование

GTPOH

+

[Экзон 1]upAИнтронGpa[Экзон 2]

Расщепление

5’-концевого сайта

сплайсинга

[Экзон 1]uOH

GpAИнтронGpa[Экзон 2]

Лигирование

экзонов

[Экзон 1]upa[Экзон 2]

+

GpAИнтронG

GTPOH

+

[Экзон 1]upAИнтронGpa[Экзон 2]

Интеграция

интрона в

прежнее место

[Экзон 1]uOH

GpAИнтронGpa[Экзон 2]

Лигирование

экзона 2 и интрона

[Экзон 1]upa[Экзон 2]

+

GpAИнтронG

 

Строчными буквами в таблице изображены нуклеотиды, принадлежащие экзонам, а прописными – интронам. Прямая и обратная реакции не требуют белковых катализаторов. Однако в ряде случаев интроны I и II групп могут кодировать полипептид, названный матуразой (maturase, от англ. mature – созревать), который необходим для эффективного аутосплайсинга и транспозиции интронов in vivo.

Аутосплайсинг интронов группы I начинается с нуклеофильной атаки 2’-OH-группы GTP по фосфодиэфирной связи в 5’-концевом сайте сплайсинга (см. табл. I.10) (присутствие GTP в качестве кофактора необходимо для протекания данной реакции). При этом происходит освобождение 5’-концевого экзона 1. Образовавшиеся половинки молекулы удерживаются рядом друг с другом водородными связями. Освободившаяся 3’-OH-группа экзона 1 далее атакует фосфодиэфирную связь в 3’-концевом сайте сплайсинга, что сопровождается расщеплением этой связи и полным освобождением интрона. Одновременно происходит лигирование двух экзонов. Все этапы этой реакции обратимы. В обратной реакции после связывания соответствующего участка лигированных экзонов "активным центром" вырезанного интрона последний атакует своей концевой 3’-OH-группой фосфодиэфирную связь в месте стыковки экзонов, что сопровождается объединением интрона и экзона 2. На втором этапе 3’-OH-группа экзона 1 атакует фосфатную группу по первой фосфодиэфирной связи интрона, освобождая остаток G, с последующим объединением экзона 1 с остальной частью молекулы.

Аутосплайсинг интронов II и III групп протекает по другому механизму (см. рис. I.15,в). Реакция также осуществляется в два этапа. На первом этапе 2’-OH-группа аденозина, находящегося в точке разветвления интрона, вырезаемого из предшественника РНК, атакует фосфодиэфирную связь 5’-концевого сайта сплайсинга, что сопровождается освобождением экзона 1 и образованием промежуточной структуры в виде лассо. В таком промежуточном соединении 5’-концевой нуклеотид интрона соединен 2’–5’-фосфодиэфирной связью с этим остатком аденозина, образуя петлю на конце интрона. На втором этапе 3’-концевая OH-группа экзона 1 атакует 3’-концевой сайт сплайсинга. В результате происходит объединение экзонов и освобождается интрон с петлей на 5’-конце. В заключение следует отметить одно замечательное свойство этой группы реакций. Поскольку число фосфодиэфирных связей на протяжении всех преобразований остается неизменным, они не требуют затраты дополнительной энергии и протекают самопроизвольно.

Сплайсинг у ядерных пре-мРНК. Исследование механизмов сплайсинга у ядерных пре-мРНК показало, что они существенно не отличаются от только что рассмотренных механизмов, используемых для удаления интронов II и III групп, однако ряд различий имеется.

Структура интронов, удаляемых из предшественников РНК аутосплайсингом, высококонсервативна. У интронов ядерных РНК консервативны лишь короткие последовательности в окрестностях сайтов сплайсинга и точки разветвления. Вторая отличительная особенность сплайсинга у ядерных пре-мРНК – потребность в ATP и мяРНП, формирующих сплайсому. Тем не менее, одинаковые черты этих двух систем сплайсинга более существенны. Малые ядерные РНК, входящие в состав мяРНП и сплайсомы, участвуют в распознавании сайтов сплайсинга и точки разветвления, а также в правильном ориентировании экзонов по отношению друг к другу. Их OH-группы осуществляют атаку фосфодиэфирной связи 5’-концевого сайта сплайсинга на первом этапе реакции. Так же как и в случае интронов II и III групп, для вырезаемого интрона характерна структура типа лассо.

Распознавание канонических сайтов при сплайсинге ядерных пре-мРНК. Для полного прохождения всех реакций сплайсинга его аппарат (сплайсома) должен распознавать на пре-мРНК три критические последовательности нуклеотидов: 3’- и 5’-концевые сайты сплайсинга и точку разветвления. В соответствии с наиболее распространенной моделью поиска экзонов в пре-мРНК с большими интронами, аппарат сплайсинга, прежде всего, отыскивает два близкорасположенных сайта сплайсинга в нужной ориентации. Распознавание конкретной пары сайтов сплайсинга в пре-мРНК дрожжей начинается с взаимодействия по принципу комплементарности между последовательностями этих сайтов и 5’-концевыми участками мяРНК U1, входящих в состав U1-мяРНП-частиц в случае 5’-концевых сайтов сплайсинга, а также белка U2AF65, находящегося в комплексе с U2AF35, с последовательностью 3’-концевого сайта сплайсинга. Эффективность функционирования сайтов сплайсинга зависит от степени соответствия их первичной структуры консенсусным последовательностям.

Сближение двух сайтов сплайсинга, сопровождаемое выпетливанием последовательности интрона, осуществляется с участием SR-белков, обогащенных Ser и Arg, которые взаимодействуют с 70К-белком (70 кДа), входящим в состав U1-мяРНП-частицы, а также U2AF35 на другом конце интрона. Такие комплексы, образованные с участием SR-белков, получили название "коммитированных комплексов".

В то время как 5’-концевые сайты сплайсинга довольно консервативны, 3’-концевые сайты обнаруживают большую вариабельность. U1-мяРНП, находящиеся в комплексе с 5’-концевым сайтом сплайсинга, стимулируют присоединение белков U2AF к 3’-концевому сайту и способствуют правильному распознаванию соответствующего экзона в процессе, получившем название "определение экзона". Эффективное распознавание сайтов сплайсинга соответствующими белками является критическим этапом в правильном и упорядоченном удалении экзонов из пре-мРНК в процессе конститутивного сплайсинга.

Механизмы определения экзонов. Гены позвоночных, как правило, содержат большое число мелких экзонов (средняя длина  137 п.о.), разделенных протяженными последовательностями интронов, длина которых может превышать 100 т.п.о. При этом ферментные системы, осуществляющие сплайсинг, должны распознавать небольшие экзоны, затерянные среди гигантских некодирующих последовательностей, и осуществлять их правильное объединение друг с другом. Как уже упоминалось выше, канонические (консенсусные) последовательности, необходимые для распознавания экзонов, располагаются на концах интронов. Однако в отличие от соответствующих последовательностей интронов дрожжей регуляторные последовательности в окрестностях сайтов сплайсинга животных менее консервативны, и это, на первый взгляд, значительно усложняет задачу распознавания экзонов системами сплайсинга. В действительности распознавание индивидуальных сайтов сплайсинга у животных, по-видимому, не связано с независимым распознаванием канонических последовательностей в окрестностях каждого экзона. В соответствии с наиболее популярной в настоящее время моделью определения экзонов у животных, взаимодействие между соседними сайтами сплайсинга в генах с короткими экзонами и длинными интронами происходит не через интроны, а через последовательности экзонов. Предполагается, что у пре-мРНК с длинными интронами система сплайсинга, прежде всего, отыскивает пару близкорасположенных сайтов сплайсинга, фланкирующих короткие последовательности экзонов (рис. I.16,а). После распознавания такой пары с ними взаимодействуют U1- и U2-мяРНП и ассоциированные факторы сплайсинга, включая факторы, распознающие 3’-концевые сайты сплайсинга – U2AF и SC35, а также фактор, узнающий 5’-концевой сайт сплайсинга – ASF/SF2. После завершения процесса определения экзона соседние экзоны входят в контакт друг с другом в результате взаимодействия между факторами, распознающими индивидуальные экзоны. Таким образом, в соответствии с этой моделью процесс сборки активной сплайсомы у позвоночных проходит в два этапа, включающие определение экзонов и их сближение между собой. В генах с небольшими интронами, например у низших эукариот, по-видимому, реализуется альтернативный механизм (см. рис. I.16,б). В этом случае первым этапом сборки сплайсомы является определение интрона.

В результате мутаций, связанных с нарушением сплайсинга, возникает, по крайней мере, четыре фенотипа: игнорирование экзона, который вырезается вместе с интронами; активация новых (криптических) сайтов сплайсинга; возникновение внутри интронов псевдоэкзонов, последовательности которых не вырезаются из пре-мРНК, и игнорирование интронов. Частоты этих мутаций составляют соответственно 51, 32, 11 и 6%. Все фенотипы, за исключением последнего, могут быть объяснены на основе обсуждаемой модели определения экзонов.

Эта же модель позволяет предсказывать максимальные и минимальные размеры экзонов в генах эукариот. Действительно, анализ длин 1600 внутренних экзонов показал, что только 3,5% из них содержат более 300 нуклеотидов и менее 1% – 400 нуклеотидов. Кроме того, доля экзонов, длина которых меньше 50 нуклеотидов, в этой выборке также незначительна. Известно, что в опытах in vitro сплайсинг резко ингибируется, если длина внутренних экзонов превышает 400 нуклеотидов или становится меньше 50 нуклеотидов. Все эти факты делают модель определения экзонов весьма правдоподобной. Более короткие экзоны, длина которых составляет 6 или 7 п.о., часто обнаруживаемые в генах белков мышц, распознаются системой сплайсинга через энхансерные регуляторные последовательности, расположенные в интронах рядом с экзонами. Механизм распознавания очень длинных экзонов остается неизвестным.

  1.  Кэп-связывающий комплекс в роли фактора, сопрягающего основные реакции метаболизма транскриптов РНК-полимеразы II

РНК не может находиться in vivo в свободном виде. На протяжении всего внутриклеточного существования – от инициации биосинтеза до полной деградации – РНК пребывает в составе рибонуклеопротеиновых комплексов (РНП). Интенсивные исследования РНП-частиц выявили множество белков, образующих такие комплексы. Поскольку почти все мРНК эукариот претерпевают одни и те же внутриклеточные превращения, основными из которых являются кэпирование, полиаденилирование и сплайсинг, в составе РНП обнаруживают ограниченный набор белков, обеспечивающих протекание этих процессов. Помимо белков, необходимых для специфической трансляции мРНК определенных видов, а следовательно, и ассоциированных только с этими видами мРНК, два белка представлены почти во всех цитоплазматических мРНП животных в больших количествах – уже обсуждавшийся выше поли(А)-связывающий белок PABP и белок р50. Роль последнего как универсального регулятора трансляции обсуждается в разделе 3.4. Здесь же будут рассмотрены другие, не менее универсальные белки мРНП, которые взаимодействуют с кэп-группами и обеспечивают сопряжение основных реакций посттранскрипционных модификаций мРНК эукариот и экспорта мРНП из ядра в цитоплазму.

Ядерный кэп-связывающий комплекс (CBC). Присоединение кэп-группы к любой строящейся цепи мРНК эукариот, что является ее первой (котранскрипционной) модификацией, оказывает глобальное влияние на все последующие реакции внутриклеточного метаболизма мРНК, включая ее трансляцию. Наличие кэп-группы дает возможность мРНК специфически взаимодействовать с белковым ядерным кэп-связывающим комплексом CBC (cap-binding complex). Очищенный до гомогенности CBC представляет собой гетеродимер белков CBP80 (молекулярная масса 80 кДа) и CBP20 (20 кДа). N-Концевая часть большой субъединицы CBC содержит сигнал ядерной локализации NLS (nuclear localization signal), обеспечивающий челночные функции CBC во время экспорта мРНП из ядра в цитоплазму (см. ниже). Для взаимодействия CBC с кэп-группой мРНК требуются обе его субъединицы, которые по отдельности не обладают кэп-связывающими свойствами. Обсуждаемые функции CBC сохраняются у всех исследованных видов эукариот – от дрожжей до человека.

Роль CBC в сплайсинге пре-мРНК. Уже более 15 лет известно, что кэп-структура m7G необходима для эффективного сплайсинга пре-мРНК в бесклеточных экстрактах клеток животных. Было установлено, что сплайсинг пре-мРНК с одним интроном подавляется в присутствии экзогенных аналогов кэпа или кэп-содержащих РНК. Резкое ингибирование сплайсинга наблюдали в экстрактах, истощенных с помощью специфических антител по большой субъединице CBC – CBP80. Дальнейшее всестороннее изучение этого явления показало, что гетеродимерный CBC требуется для эффективного сплайсинга кэпированных пре-мРНК.

Оказалось, что во время сплайсинга больших пре-мРНК кэп-группа оказывает влияние лишь на вырезание ближайшего к ней интрона. На рис. I.16в схематически представлены результаты опытов, особенно четко демонстрирующих данное явление. В этих экспериментах использовали искусственные кэпированные пре-мРНК с двумя интронами, которые содержали один или несколько мутантных канонических сайтов сплайсинга в разных комбинациях. Инактивация 5'-концевого сайта сплайсинга первого интрона не оказывала влияния на вырезание второго интрона и блокировала вырезание первого (см. рис. I.16,в,2). Мутация в ближайшем к кэп-группе 3'-концевом сайте сплайсинга сопровождалась вырезанием большой последовательности, включающей оба интрона и второй экзон, расположенный между ними (см. рис. I.16,в,3). Такая конструкция процессировалась как пре-мРНК, содержащая только один интрон, вырезание которого зависело от наличия комплекса CBC. В том случае, если были инактивированы как 3'-, так и 5'-концевой сайты сплайсинга первого интрона, вырезание второго интрона происходило независимо от CBC (в истощенных по комплексу экстрактах) (не отражено на рисунке). Лишь одновременное разрушение 5'-концевого сайта сплайсинга и полипиримидиновой последовательности первого экзона сопровождалось появлением CBC-зависимости вырезания второго интрона (см. рис. I.16,в,4). (Полипиримидиновая последовательность обсуждалась выше, в начале подраздела, посвященного сплайсингу.) Полученные данные показывают, что именно полипиримидиновая последовательность, а не 5'-концевой сайт сплайсинга первого экзона, обеспечивает кэп-независимое вырезание второго интрона. Принимая во внимание, что CBC необходим для эффективного взаимодействия U1-мяРНП с 5'-концевым сайтом сплайсинга ближайшего к нему интрона, высказывают предположение, что полипиримидиновая последовательность, расположенная перед центральным экзоном, выполняет аналогичные функции при определении этого экзона системой сплайсинга.

Сопряжение сплайсинга с формированием 3'-концевых последовательностей пре-мРНК. Для предшественников мРНК, не содержащих кэп-групп, характерна малая эффективность процессинга их 3'-концевых последовательностей в экстрактах ядер. Кроме того, в таких бесклеточных системах расщепление кэпированной пре-мРНК вблизи поли(А)-сайта подавляется аналогом кэп-группы m7GpppG и не происходит в экстрактах, истощенных по CBC с помощью антител. На основании такого рода данных делается вывод, что во время процессинга пре-мРНК CBC пространственно сближен с комплексом белков системы, формирующей 3'-концевые последовательности, и стабилизирует этот комплекс через белок–белковые взаимодействия, что необходимо для его эффективного функционирования. Пространственное сближение 5'- и 3'-концевых последовательностей было прямо продемонстрировано для РНП гигантских (35–40 т.о.) транскриптов колец Бальбиани.

В соответствии с современной моделью, поли(А)-сайт пре-мРНК участвует в определении ее последнего интрона вместо обычно используемого для этой цели 5'-концевого сайта сплайсинга. Недавно было установлено, что, в свою очередь, и 3'-концевой сайт сплайсинга последнего интрона стимулирует полиаденилирование пре-мРНК, а следовательно, и процесс удаления последнего интрона сопряжен с полиаденилированием предшественника.

Участие CBC в экспорте транскриптов РНК-полимеразы II из ядер в цитоплазму. Транскрипты РНК-полимеразы II разделяют, по крайней мере, на два больших класса: мРНК и U-мяРНК. Для РНК обоих классов характерно наличие кэп-групп, но малые ядерные РНК не полиаденилированы. Наличие кэп-группы резко стимулирует экспорт этих РНК из ядер в цитоплазму. С помощью иммуноэлектронной микроскопии удалось осуществить наблюдения in situ за динамикой ассоциации, экспорта, а также диссоциации субъединиц CBC и транскриптов колец Бальбиани, которые представляют собой гигантские пуффы на политенных хромосомах слюнных желез комара Chironomus tentans. Проведение прямых наблюдений стало возможным благодаря большому размеру транскриптов колец Бальбиани (35–40 т.п.о.) и, как следствие, их пре-мРНП, в состав каждого из которых входит до 200 молекул белков. Было установлено, что белки CBC выходят из ядер в составе мРНП и повторно импортируются в ядра. При этом, в соответствии с современной моделью, происходит следующая последовательность реакций.

Как уже упоминалось, большая субъединица CBC CBP80 содержит специфическую аминокислотную последовательность – сигнал ядерной локализации (NLS). Гетеродимерный цитоплазматический рецептор этого сигнала животных состоит из двух субъединиц – импортина α (молекулярная масса 60 кДа) и импортина β (90 кДа). В цитоплазме импортин α взаимодействует непосредственно с NLS белков, импортируемых в ядро, и импортином β, который в, свою очередь, содержит сайт взаимодействия с ядерным поровым комплексом NPC (nuclear pore complex). Через NPC происходит обмен макромолекулами ядра и цитоплазмы. Белки, содержащие NLS, в комплексе с рецептором переносятся в ядро, где рецептор диссоциирует на субъединицы. Диссоциация рецептора на две субъединицы импортина в нуклеоплазме запускается особым ферментом, GTPазой Ran, связанной с GTP, сродство к которой импортина β выше, чем к импортину α. В результате импортин β удаляется из комплекса. В настоящее время не исключается возможность того, что диссоциировавшая субъединица импортина β остается связанной с цитоплазматической частью NPC. Механизм дальнейшей диссоциации импортина α и NLS не ясен. Полагают, что выход импортина β из комплекса ослабляет связь импортина α и NLS большинства ядерных белков, но не большой субъединицы CBC, с которой импортин α взаимодействует особенно прочно.

В ядре синтезированные РНК через кэп-группу взаимодействуют с CBC, находящимся в комплексе с импортином α, и через NPC перемещаются из ядра в цитоплазму. На цитоплазматической части NPC или в цитоплазме к комплексу CBC–РНК–импортин α присоединяется импортин β через импортин β-связывающий домен импортина α. Это облегчается тем, что в цитоплазме GTPаза Ran находится в комплексе с GDP из-за присутствия так называемого белка 1, активирующего GTPазу Ran (Ran GAP1), которая в его присутствии гидролизует связанный с ней GTP. Благодаря особым свойствам NLS кэп-связывающего комплекса CBC, присоединение импортина β в данном случае сопровождается диссоциацией РНК и белкового комплекса CBC-рецептор. В таком виде белковый комплекс переносится в нуклеоплазму, и цикл экспорта синтезированной РНК начинается сначала. В случае U–гяРНП такая цитоплазматическая диссоциация комплекса приводит к гиперметилированию кэп-группы гяРНК, сборке нового комплекса и реимпорту его вместе с гяРНК в ядро. Освобождение кэп-группы мРНК после ее выхода из ядра в цитоплазму делает возможным взаимодействие с ней фактора инициации трансляции eIF-4E с последующим вовлечением мРНК в синтез белка (см. раздел 2.5.1).

Участие CBC в сборке РНП-частиц и формировании правильной пространственной структуры мРНК. Большинство информации о сборке РНП-частиц и механизмах формирования пространственной структуры мРНК в цитоплазме получено с использованием транскриптов колец Бальбиани. Поэтому остается под сомнением возможность распространения выявленных закономерностей на другие транскрипты.

Сборка РНП-частиц осуществляется котранскрипционно (т.е. одновременно с транскрипцией) и начинается с 5'-конца растущей цепи РНК. Поскольку присоединение CBC к кэп-группе происходит одним из первых, полагают, что это инициирует упорядоченное взаимодействие с РНК других белков, входящих в состав гяРНП, с образованием РНП-фибриллы. Наличие кэп-группы дает возможность соответствующим механизмам функционально различать транскрипты РНК-полимераз I, II и III. Действительно, РНК, синтезируемые РНК-полимеразами I и III, не содержат на своих 5'-концах m7G-групп, включаются в РНП в составе других белков и не подвергаются сплайсингу и полиаденилированию. Для этих транскриптов характерны и другие механизмы транспорта из ядра в цитоплазму. Полагают, что набор белков, ассоциированных с РНК разных классов, определяется, прежде всего, особенностями их первичной структуры. В то же время белки РНП обеспечивают РНК пространственную структуру, оптимальную для ее дальнейшего внутриклеточного метаболизма и функционирования.

  1.  Функциональная компартментализация ядра

При рассмотрении механизмов реализации генетической информации на уровне транскрипции и посттранскрипционных модификаций РНК чаще всего не принимается во внимание пространственная внутриклеточная организация макромолекулярных комплексов, обеспечивающих осуществление этих механизмов. Имеются, по крайней мере, две причины, по которым такого рода вопросам в современных исследованиях уделяется недостаточное внимание. Во-первых, большинство молекулярно-генетических исследований механизмов транскрипции проводится в бесклеточных системах, где вполне удовлетворительно выявляются отдельные компоненты функциональных макромолекулярных комплексов и их биохимические функции. Во-вторых, такие эксперименты сопряжены со значительными методическими сложностями и в настоящее время, как правило, ограничиваются различными приложениями микроскопии в сочетании с молекулярными зондами. Однако переход с фундаментального молекулярного уровня исследований в бесклеточных системах ("метаболического котла") на более высокий, учитывающий пространственную организацию биохимических процессов, неизбежен, так как именно на нем реализуются жизненно важные принципы интеграции и регуляции метаболизма живого организма во всех его проявлениях.

Концепция функциональной компартментализации эукариотической клетки в настоящее время общепринята и основывается на признании существования многочисленных внутриклеточных органелл, одной из которых является ядро. Наличие дискретных микрокомпартментов в отдельных органеллах менее очевидно, однако реально подтверждается в эксперименте. Результаты, полученные при использовании нескольких независимых подходов, указывают на компартментализацию процессов репликации, транскрипции и процессинга РНК в эукариотических ядрах. Так, синтез ДНК и РНК тонко организован во времени и пространстве. Интерфазные хромосомы занимают в ядрах вполне определенные микрокомпартменты (хромосомные зоны или территории) и не перемешаны друг с другом. При этом их пространственная структура высокоупорядочена.

  1.  Интерфазные хромосомы в ядре

В разделе 1.3 уже кратко обсуждался петельно-доменный уровень структурной организации хромосом эукариот, который отражает разделение интерфазных хромосом на дискретные домены по функциональному признаку. Наибольшее число экспериментальных данных в пользу наличия таких функциональных доменов было получено в исследованиях хромосом дрозофилы в связи с мозаичным эффектом положения, в которых использовались методы генетического анализа в сочетании с цитологическими наблюдениями политенных хромосом. Феномен эффекта положения и молекулярные механизмы, лежащие в его основе, будут более подробно рассмотрены в разделе 3.2.4. Говоря коротко, эффект положения заключается в том, что перенос активно транскрибируемых генов к неактивным гетерохроматизированным участкам хромосом часто сопровождается значительным подавлением транскрипционной активности генов в их новом положении на хромосоме. Возможен поиск генов, ингибирующих или усиливающих эффект положения генов-репортеров, уровень экспрессии которых легко устанавливается фенотипически, например по изменению интенсивности окраски глаз. Многие из идентифицированных таким образом генов кодируют структурные компоненты хроматина или ферменты, ковалентно модифицирующие эти компоненты.

Эффект положения рассматривается в настоящее время в качестве универсального явления, характерного для всех эукариотических хромосом. Он наглядно демонстрирует наличие в интерфазных хромосомах высокоупорядоченной доменной структуры, тесно связанной с транскрипционной активностью соответствующих участков генома. Распределение участков хроматина с разным уровнем конденсированности в интерфазных хромосомах упорядочено и, по-видимому, является видовым признаком организма. Имеются указания на то, что структурные компоненты конденсированного хроматина оказывают влияние на пространственное расположение соответствующих частей хромосом в ядре. Следовательно, такая их микрокомпартментализация может играть важную роль в регуляции экспрессии генов.

Уже в ранних цитологических экспериментах (С. Рабл, 1885 г.) было показано, что теломерные участки хромосом клеток слюнных желез саламандр располагаются вблизи ядерной оболочки. В настоящее время установлена локализация на периферии ядер теломер политенных хромосом дрозофилы, а также теломерных участков хромосом Schizosaccharomyces pombe в фазе G2 клеточного цикла. С помощью конфокальной иммунофлуоресцентной микроскопии продемонстрировано, что перинуклеарную локализацию теломер дрожжей S. cerevisiae обеспечивают, по крайней мере, два белка – Sir3 и Sir4 (silent information regulators), которые также требуются для наследуемой инактивации генов в специфических доменах хромосом, расположенных в локусе, определяющем тип спаривания у дрожжей, и вблизи теломерных последовательностей. В такого рода экспериментах была установлена связь между ядерной локализацией конкретных участков хромосом и их транскрипционной активностью.

В отличие от теломерных участков хромосом, активно экспрессирующиеся гены локализуются преимущественно во внутренних частях интерфазных ядер. При этом, по мнению Д.Б. Лоуренса и соавторов (1993 г.), отдельные гены внутри ядер располагаются упорядоченно. В частности, было установлено, что активно транскрибируемые гены вируса Эпштейна–Барр и онкогена neu находятся в разных местах внутренних 50% ядерного объема, а ген дистрофина – вблизи ядерной оболочки. В этой серии экспериментов три неактивных гена, кодирующих альбумин, тяжелую цепь сердечного миозина и нейротензин, локализовали в составе конститутивного гетерохроматина на периферии ядер или вблизи ядрышка. Используя микрооблучение ультрафиолетовым светом и гибридизацию с зондами, показали, что отдельные хромосомы занимают внутри ядра дискретные, хотя и обширные, территории. Компоненты аппарата сплайсинга обнаруживают в ядрах на периферии территорий, занимаемых индивидуальными хромосомами, так же как и треки синтезируемой РНК (см. ниже). В соответствии с моделью Т. Кремера (1993 г.), внутриядерное пространство между территориями, занимаемыми индивидуальными хромосомами, представляет собой единый компартмент, в котором происходят транскрипция, сплайсинг, созревание транскриптов и их транспорт. Этот компартмент тесно ассоциирован с активно транскрибируемыми генами, которые располагаются на периферии хромосомных территорий в составе выступающих петель хроматина. Несмотря на большую функциональную важность обсуждаемого вопроса, истинная природа интерфейса между активными генами отдельных хромосомных территорий и межхроматиновым компартментом остается неясной из-за слабого понимания пространственной структуры ДНК на высших уровнях ее упаковки в хромосомах.

  1.  Ядрышко

Структурно-функциональная организация ядрышка (nucleolus) еще более наглядно иллюстрирует концепцию функциональной компартментализации ядра эукариотических клеток. В этой части ядра происходят транскрипция рибосомных генов, процессинг предшественников рРНК и сборка прерибосомных частиц из рибосомных белков и рРНК. Механизмы формирования ядрышка, приводящие к образованию внутри ядра этой дискретной и легко обнаруживаемой структуры, в настоящее время не ясны. В соответствии с одной из простых гипотез, ядрышко рассматривают как нуклеопротеиновый комплекс, спонтанно появляющийся в результате объединения регуляторных белково–нуклеиновых комплексов, возникающих на повторяющихся последовательностях рДНК во время их транскрипции. Действительно, гены рРНК человека организованы в виде 250 тандемно повторяющихся последовательностей длиной в 44 т.п.о. каждая, которые вместе с ассоциированными с ними белками формируют сердцевину ядрышка. Оно заполняется другими компонентами во время процессинга рРНК и сборки рибосомных субчастиц.

Морфологически в ядрышке различают три основные зоны: фибриллярный центр (1), окруженный плотной фибриллярной (2) и гранулярной (3) областями. С помощью специфических антител и гибридизационных зондов было установлено, что в фибриллярном центре ядрышка локализованы гены рРНК, РНК-полимераза I, транскрипционный фактор UBF и топоизомераза I. Полагают, что фибриллярный центр ядрышка является местом сборки регуляторных нуклеопротеиновых комплексов, необходимых для транскрипции генов рРНК. Плотный фибриллярный компонент, окружающий центр ядрышка, представлен растущими цепями предшественников рРНК и ассоциированными с ними белками, участвующими в процессинге. В гранулярной области ядрышка обнаруживают зрелые 28S и 18S рРНК, частично процессированные РНК, а также продукты сборки рибосомных субчастиц. Интермедиаты сборки рибосом представлены частицами диаметром 15–20 нм. Перенос прерибосомных субчастиц к цитоплазме, по-видимому, обеспечивают специфические белки, которые направленно перемещаются от ядрышка к оболочке ядра. Благодаря четко прослеживаемой иерархии в структурно-функциональной организации ядрышка в виде отдельных морфологически различимых компартментов его часто используют в качестве модели функциональной компартментализации синтеза мРНК, ее процессинга и экспорта в цитоплазму.

При этом следует иметь в виду, что наблюдаемая "высокоупорядоченная" пространственная структура ядрышка может быть просто следствием функционирования большого числа генов рРНК, организованных в тандемные повторы, что сопровождается накоплением транскриптов РНК-полимеразы I и продуктов их процессинга в окрестностях активно работающих генов. Структура ядрышка является динамической, а его пространственное расположение и структурные особенности зависят от внутриядерной локализации и уровня активности соответствующих генов рРНК.

Долгое время ядрышко рассматривалось только в обсуждаемом выше аспекте, т.е. как внутриядерный микрокомпартмент биогенеза рибосом, в котором происходят транскрипция рДНК и сборка рибосомных субчастиц из составляющих компонентов. Однако в последнее время начинают появляться данные, указывающие на участие ядрышка в регуляции клеточного цикла.

Даже геном дрожжей содержит ~200 тандемно повторяющихся генов рРНК. При этом не все гены одинаковы в функциональном отношении: транскрибируется лишь половина последовательностей рДНК, а в их воспроизводстве задействовано лишь ~20% имеющихся областей начала репликации. Перенос генов в область рДНК часто сопровождается их репрессией, что, как полагают, является следствием функционирования механизма подавления гомологичной рекомбинации в участках генома, содержащих тандемные повторы. Мутационное нарушение этого механизма сопровождается образованием сотен внехромосомных кольцевых рДНК, которые неравномерно распределяются между дочерними клетками во время митоза. Накопление материнскими клетками внехромосомных рДНК приводит к уменьшению способности клеток делиться. Этот феномен был назван "старением клеток" (cellular aging). Кроме того, складывается впечатление, что ядрышко может регулировать вхождение клеток в мейоз, а также активность фосфатазы Cdc 14, контролирующей прохождение телофазы митоза. Получены данные о том, что повторяющиеся последовательности рДНК ядрышка служат местом сборки большого регуляторного белкового комплекса RENT (regulator of nucleolar silencing and telophase exit), в состав которого входит вышеупомянутая фосфатаза и, как минимум, три других белка, которые и обеспечивают регуляторные функции ядрышка.

  1.  Пространственная организация синтеза мРНК

Внутриядерный синтез мРНК и доставка зрелых транскриптов к месту их трансляции требуют участия множества тонко сбалансированных во времени, пространственно организованных молекулярных механизмов. Выше уже были рассмотрены основные молекулярные процессы, обеспечивающие сборку инициационных и элонгирующих нуклеопротеиновых комплексов, а также механизмы котранскрипционных и посттранскрипционных модификаций РНК, включая кэпирование, сплайсинг, редактирование их первичной структуры и полиаденилирование. Теперь кратко суммируем известные факты о внутриядерной компартментализации этих процессов.

Аппарат транскрипции, участвующий в синтезе пре-мРНК, ассоциирован с перихроматиновыми фибриллами, обнаруживаемыми на границах доменов конденсированного хроматина. Эти фибриллы представляют собой ядерные рибонуклеопротеиновые комплексы диаметром 3–20 нм. Они включают в себя растущие цепи пре-мРНК, и плотность фибрилл коррелирует с транскрипционной активностью соответствующих участков хроматина. С помощью иммунохимических методов здесь же обнаружены компоненты аппарата сплайсинга, который удаляет интроны из предшественников мРНК одновременно с элонгацией транскриптов.

В опытах по внутриядерной локализации мест синтеза специфических транскриптов с использованием импульсной радиоактивной или флуоресцентной меток такие РНК были обнаружены в виде "треков" или более компактных "точек" в одном или двух дискретных участках ядра, что соответствует копиям соответствующих генов на гомологичных хромосомах. При этом с использованием одновременной гибридизации ДНК и РНК было показано, что транскрибируемые гены расположены прямо в треках или точках на одном из концов трека. Более того, зонды, специфичные в отношении последовательностей интронов, метят треки только вблизи гена, указывая на то, что сплайсинг происходит вдоль этого следа РНК.

Треки РНК тесно ассоциированы с дискретными внутриядерными структурами, называемыми межхроматиновыми гранулами, или спеклами. Спеклы обогащены компонентами аппарата сплайсинга, а также содержат интронсодержащие пре-мРНК и полиаденилированные молекулы. В соответствии с этим спеклы могут представлять собой места процессинга пре-мРНК и аккумуляции зрелых мРНК внутри ядер. В ряде случаев выявляется неслучайная ассоциация активно транскрибируемых генов со спеклами, которые могут маркировать внутриядерные области транскрипции. Противоречивость этой интерпретации заключается в том, что в ядре обнаруживаются одновременно всего 20–50 спеклов, тогда как транскрибирующихся генов значительно больше. Следовательно, не каждый транскрибируемый ген ассоциирован с такими структурами. Большинство экспериментальных доказательств ассоциации мест транскрипции со спеклами получено для особо активных генов, например гена коллагена, транскрипты которого в фибробластах составляют до 4% суммарной РНК. Возможно, спеклы представляют собой микрокомпартменты, в которых происходит процессинг РНК наиболее активно транскрибируемых генов.

После завершения синтеза и объединения с компонентами аппарата сплайсинга, формирующими сплайсомы, пре-мРНК переносится к ядерной оболочке и выходит в цитоплазму. Выход РНК из ядра в цитоплазму осуществляется через поры в ядерной оболочке, входящие в состав ядерного порового комплекса (NPC). NPC является постоянно существующим микрокомпартментом, однозначно идентифицируемым с помощью микроскопических, генетических и биохимических методов.

Во время внутриядерного транспорта молекулы РНК объединяются с другими белками, участвующими в их процессинге, образуя гетерогенные ядерные рибонуклеопротеиновые комплексы (гяРНП), в которых пространственная структура пре-мРНК оптимизирована для ее созревания. Ядерный матрикс, получаемый в результате удаления из ядер большей части хроматина, все еще содержит пре-мРНК, гяРНП и некоторые компоненты аппарата сплайсинга. Это может указывать на внутриядерную избыточность гяРНП и их роль в формировании пространственной структуры ядер. В общем, для гяРНП характерно диффузное распределение в нуклеоплазме, однако часть из них может концентрироваться в окрестностях спеклов и даже следовать за РНК из ядра в цитоплазму и вновь возвращаться в ядра вместе с транскриптами.

Процесс перемещения специфических пре-мРНК от генов в цитоплазму клеток был подробно исследован в случае экспорта частиц пре-мРНП колец Бальбиани комара Chironomus tentans, экспрессирующиеся гены которых находятся в составе гигантских пуффов политенных хромосом слюнных желез. Крупные транскрипты этих пуффов во время элонгации упаковываются в гяРНП в виде тонких фибрилл, которые по мере удлинения пре-мРНК становятся толще и изгибаются с образованием кольцеобразных структур. Зрелые гранулы пре-мРНП, которые, как полагают, заключают в себе РНК, претерпевшую сплайсинг, движутся в нуклеоплазме к ядерной оболочке, где задерживаются вблизи ядерных пор. В это время они приобретают форму палочек, которые проходят через ядерные поры, начиная с 5’-конца заключенной в них РНК. Как только пре-мРНК появляются на поверхности цитоплазматической части ядерной мембраны, они объединяются с рибосомами. Следует подчеркнуть, что на протяжении всей этой цепи событий РНК находится в составе пространственно упорядоченных РНП-частиц. Накапливаются данные в пользу того, что перемещение РНК от гена к ядерной мембране не является следствием простой диффузии. Такому простому объяснению, в частности противоречат факты тесной ассоциации транскриптов, гяРНП и компонентов аппарата сплайсинга с ядерным матриксом. В ряде случаев находит подтверждение гипотеза ядерной фиксации генов (gene gating model), предложенная Г. Блобелом (1985 г.), в соответствии с которой конкретные гены функционально связаны с определенными участками (и порами) ядерной мембраны, что направляет их транскрипты для экспорта в цитоплазму к этим конкретным участкам. Однако такое правило подтверждается не всегда. В частности, РНК коллагена обнаруживают распределенной вдоль всей ядерной мембраны, что указывает на ее выход в цитоплазму через многие ядерные поры.

Для рассмотренных выше структур, образование которых сопровождает синтез, процессинг и экспорт РНК из ядра в цитоплазму, характерен динамизм – отдельные их компоненты могут перемещаться между микрокомпартментами. Синтез, процессинг и транспорт РНК в ядре происходят в составе дискретных компартментов нуклеоплазмы, что позволяет концентрировать регуляторные, структурные и ферментативные компоненты транскрипции и сплайсинга в местах активно экспрессирующихся генов. Действительно, все этапы сплайсинга можно воспроизвести в разбавленных растворах in vitro при концентрации белка 1 мкг/мл. Однако скорость этих реакций в таких системах значительно ниже наблюдаемой in vivo, где внутриядерная концентрация РНП превышает 50 мг/мл. Кроме того, пространственно упорядоченная организация ранних этапов экспрессии генов создает необходимые условия и дополнительные уникальные возможности для ее регуляции, что было бы невозможно в случае свободной диффузии компонентов этой системы.

  1.  Ядерные тельца и домены

Исследования структурно-функцональных отношений в ядре в связи с компартментализацией транскрипции, процессинга РНК и репликации продемонстрировали наличие особых функций у многих морфологически различимых внутриядерных микроструктур. В этом отношении не явились исключением и ядерные тельца, вначале описанные чисто морфологически.

Свернутые тельца (coiled bodies). Эти внутриядерные ультраструктуры, обнаруживаемые в виде клубка переплетенных нитей в ядрах клеток млекопитающих, часто ассоциированы с периферией ядрышка. В составе этой ультраструктуры обнаружены белки и РНК ядрышка, участвующие в модификации и процессинге рРНК, включая фибрилларин и малые ядрышковые РНК U3. В этих структурах также обнаруживают малые ядерные РНП, в частности U7-мяРНП, и некоторые специализированные белки (например койлин p80). Все это указывает на возможное участие свернутых телец в процессинге РНК. Для данных ультраструктур характерен динамизм: они исчезают в митозе и вновь возникают в фазе G1 клеточного цикла. Их количество резко возрастает в условиях стимуляции пролиферации клеток.

Аналогами свернутых телец являются снурпосомы С ядер ооцитов амфибий. Эти тельца ассоциированы с локусом гистоновых генов хромосом типа ламповых щеток и обогащены U7-мяРНК, которая вовлечена в модификацию 3’-концов гистоновых пре-мРНК. Высказывается предположение, что и снурпосомы, и свернутые тельца могут участвовать в посттранскрипционных модификациях гистоновых и других пре-мРНК.

Ядерные тельца PML. Острая промиелоцитарная лейкемия (PML) часто ассоциирована с транслокацией t(15;17) (перенос участка хромосомы 15 на хромосому 17), которая приводит к слиянию в одной рамке считывания гена PML с геном -рецептора ретиноевой кислоты. У нормальных индивидуумов белок PML, обладающий Zn2+-связывающим доменом типа "пальцы RING", локализован в отдельном ядерном микрокомпартменте в виде плотного фибриллярного кольца, окружающего сердцевину. Этот белок обнаруживают также вместе с U1-мяРНК и койлином р80 в особых зонах, окружающих межхроматиновые гранулы, или спеклы. Ядерные тельца PML претерпевают морфологические изменения на протяжении клеточного цикла. Эти тельца разрушаются во время вирусной инфекции, а для репликации аденовирусной ДНК их разрушение является необходимым этапом, что подчеркивает возможное участие телец в обеспечении антивирусной активности клеток. Инкубация клеток с интерфероном индуцирует синтез PML-белка и подавляет размножение вирусов.

У пациентов с промиелоцитарной лейкемией, содержащих вышеупомянутый гибридный ген, имеет место разрушение ядерных телец PML. Инкубация лейкозных клеток с ретиноевой кислотой приводит к восстановлению этих морфологических структур, что коррелирует с наступлением ремиссии у больных острой промиелоцитарной лейкемией. Предполагается, что тельца PML дикого типа участвуют в подавлении неконтролируемого роста трансформированных клеток и понижают уровень их злокачественности по непонятному пока механизму.

Ядерные домены WT1. Ген WT1 человека является геном-супрессором опухолей, мутационные нарушения которого наблюдают при злокачественных новообразованиях Вилмса, возникающих в почках в детском возрасте. четыре белка, кодируемые этим геном, возникают в результате альтернативного сплайсинга, и, по крайней мере, один из них является фактором транскрипции. Для полноразмерного белка характерно наличие С-концевого мотива типа "цинковых пальцев" (см. раздел 2.2.2) и N-концевого домена, обогащенного Pro/Gln. Белок WT1 обладает способностью связываться со специфической GC-богатой последовательностью нуклеотидов и подавлять транскрипцию генов, промоторы которых содержат эту последовательность. Для него характерна дискретная внутриядерная локализация в составе морфологически различаемых телец. Ассоциация изоформ WT1 с аппаратом сплайсинга предполагает, помимо прямого влияния на транскрипцию, их участие в посттранскрипционной регуляции экспрессии генов.

  1.  Компартментализованное ядро

Два основных структурных образования характерны для ядер всех эукариот. Это, во-первых, оболочка ядра с ядерными порами, связанная с ядерной ламиной (электронно-плотный слой, прилегающий к ядерной оболочке со стороны нуклеоплазмы), и, во-вторых, хромосомы. Именно транскрипция и репликация ДНК хромосом являются теми процессами, для обеспечения которых, прежде всего, существует ядро в эукариотической клетке. Как уже было показано выше, зоны транскрипционной активности хромосом компартментализованы внутри ядер. То же характерно и для репликации ДНК эукариот (см. главу 4). Неразрешенным остается вопрос о природе внутриядерных механизмов, которые могли бы лежать в основе такой функциональной компартментализации. В этом случае фактором, осложняющим проведение исследований, является динамизм структуры хроматина, которая претерпевает упорядоченные перестройки во время репликации и транскрипции. То же относится и к пространственной структуре хромосом, изменяющейся на протяжении клеточного цикла.

Молекулярный аппарат, обеспечивающий внутриядерную экспрессию генов, их репликацию и репарацию, настолько велик, что объединение его компонентов во время функционирования может приводить к формированию надмолекулярных комплексов, различимых морфологически. Это особенно наглядно демонстрирует структура ядрышка, в котором можно легко выделить отдельные функциональные домены, содержащие: 1) регуляторные нуклеопротеиновые комплексы; 2) активно функционирующий аппарат транскрипции; 3) рибонуклеопротеиновые комплексы процессируемых транскриптов. Те же домены, хотя и менее масштабные, обнаруживаются при функционировании РНК-полимеразы II. Многие черты молекулярной организации гигантских молекулярных комплексов, обеспечивающих транскрипцию (транскриптосомы) и сплайсинг (сплайсомы) у эукариот, в настоящее время уже выяснены и были рассмотрены выше. Интенсивно исследуются молекулярная структура и пространственная организация аппарата репликации (реплисомы), которые будут подробно обсуждаться в главе 4. Однако ясное понимание внутриядерных связей между этими ключевыми комплексами в настоящее время отсутствует.

Следует особо подчеркнуть роль индивидуальных эукариотических хромосом в формировании пространственной структуры ядра. Не исключено, что необходимость организации генетического материала в виде индивидуальных хромосом, число, размер и трехмерная структура которых являются фундаментальными таксономическими признаками, продиктована потребностью соматических клеток в упорядоченном распределении матричной ДНК по внутриядерным территориям с целью координации экспрессии генов и стабилизации заключенной в них генетической информации. Выше уже отмечалась преимущественная локализация теломерных последовательностей нуклеотидов вблизи ядерной оболочки, а также расположение последовательностей наиболее активно транскрибируемых генов во внутренних частях ядер. В соответствии с одной из точек зрения (Д. Строболис, А.П. Волффе, 1996 г.), такая пространственная организация генома может облегчать экспорт синтезирующейся мРНК из ядра в цитоплазму. Однако, на мой взгляд, могут быть и более глубокие причины такой пространственной организации генома эукариот. Гетерогенность хроматина, проявляющаяся в различных уровнях его конденсации в отдельных генетических локусах, а также неслучайное внутриядерное распределение последовательностей генома создают многоуровневую защиту генетической информации от химических мутагенов и могут контролировать скорости изменения отдельных генетических локусов в филогенезе многоклеточных организмов (подробнее см. раздел 5.3). Ядро эукариот обеспечивает прохождение первых этапов реализации генетической информации: избирательную транскрипцию генов, а также посттранскрипционные модификации и процессинг предшественников РНК, которые позволяют им вступать в трансляцию, т.е. реализовывать следующий важнейший этап передачи генетической информации от генов к белкам.

  1.  Биосинтез белка рибосомами бактерий

В процесс биосинтеза белка рибосомами, называемого трансляцией, вовлечено множество макромолекул и макромолекулярных комплексов. На этом этапе реализации генетической информации происходит считывание генетической информации, заключенной в мРНК, рибосомами и ее передача полипептидным цепям белков, т.е. биосинтез полипептидных цепей, последовательность аминокислот в которых, как правило, однозначно определена последовательностью нуклеотидов в транслируемых мРНК в соответствии с генетическим кодом. Свободные аминокислоты не узнаются рибосомами. Чтобы это произошло, аминокислоты должны поступать в рибосомы в виде конъюгатов с тРНК (аминоацилированных тРНК), последовательности нуклеотидов которых распознаются аппаратом трансляции. В каждой молекуле тРНК имеется участок из трех нуклеотидов, комплементарный кодону мРНК. Именно эта последовательность, называемая антикодоном, в основном определяет положение той или иной аминокислоты в полипептидной цепи. В ходе каждого индивидуального акта трансляции рибосома распознает кодон мРНК и в соответствии с ним выбирает аминоацилированную тРНК, антикодон которой соответствует транслируемому кодону. После этого происходит соединение посредством пептидной связи очередной аминокислоты с С-концевой аминокислотой растущей цепи полипептида.

Таким образом, во время трансляции рибосома после связывания мРНК начинает последовательно, кодон за кодоном, перемещаться вдоль матрицы, выбирая из окружающей среды молекулы аминоацилированных тРНК. При этом каждый индивидуальный акт трансляции завершается присоединением выбранной молекулы аминокислоты к С-концевой аминокислоте синтезируемой цепи белка посредством пептидной связи. Ниже более подробно будут рассмотрены основные этапы биосинтеза белка и компоненты белоксинтезирующей системы бактерий.

  1.  Рибосомы

Рибосомы представляют собой крупный рибонуклеопротеидный комплекс с молекулярной массой  2,5 мДа, состоящий из рибосомных белков, молекул рРНК и ассоциированных с ними факторов трансляции. Рибосомы прокариотических и эукариотических организмов различаются по размерам. У эукариот они представлены 80S частицами, тогда как коэффициент седиментации рибосом прокариот составляет 70S. Рибосомы всех известных организмов построены из двух неравных субчастиц: прокариотические – 30S и 50S, а эукариотические – 40S и 60S. 70S рибосомы эубактерий в своем составе содержат 55–60 рибосомных белков, для 80S рибосом эукариот это число составляет 75–85. В обоих случаях рибосомные белки в составе рибосом ассоциированы с молекулами рРНК, образуя пространственно организованные рибонуклеопротеиновые тяжи.

Рибосомные белки E. coli. В настоящее время более 50 рибосомных белков выделено в высокоочищенном состоянии. Молекулярная масса самого маленького белка составляет 5 кДа, а самого большого – 61 кДа, тогда как для большинства рибосомных белков эти значения лежат в пределах 10–20 кДа. Определены аминокислотные последовательности полипептидных цепей всех рибосомных белков E. coli. Малая рибосомная субчастица содержит 21 белок с суммарной молекулярной массой 350 кДа.

Белки в составе 30S субчастицы ассоциированы с 16S РНК, длина которой составляет 1542 нуклеотида (нт). Суммарные молекулярные массы малой и большой субчастиц рибосом достигают соответственно 850 и  1450 кДа. Третья часть массы большой субчастицы приходится на 34 рибосомных белка, а две третьих – на 23S (2904 нт) и 5S рРНК (120 нт). Продолжают накапливаться биохимические данные, указывающие на центральную, возможно ключевую, роль рРНК в обеспечении этапов трансляции. Обнаружены специфические внутримолекулярные и межмолекулярные взаимодействия между различными функциональными участками рРНК. На прямое участие 23S рРНК в трансляции указывает наличие специфических комплементарных взаимодействий между ней и CCA-концами тРНК, акцептирующими аминокислотные остатки. В уточненных пространственных моделях 30S и 50S субчастиц, рассмотренных ниже, сегменты рРНК со специфическими структурными особенностями располагаются в функционально значимых участках рибосом.

Методы исследования пространственной структуры рибосом. Вся информация о пространственной структуре рибосом получена с использованием современных методов, в которых реализуются два направления исследований: структурно-биологические исследования низкого и высокого разрешения, а также биохимические – высокого разрешения. Получаемые результаты, по мере совершенствования методов, все более сближаются друг с другом.

Одними из первых следует упомянуть кристаллографию и ЯМР-спектроскопию. Имеются значительные достижения в изучении пространственной структуры небольших субдоменов рРНК с помощью ЯМР-спектроскопии, а также в исследовании структуры индивидуальных рибосомных белков с использованием методов ЯМР и кристаллографии. В последнее время закристаллизованы отдельные рибосомные субчастицы и 70S рибосомы галофильных и термофильных бактерий. Получены картины дифракции для 50S субчастиц галофилов с разрешением 3 Å, а также рибосом и субчастиц T. thermophilus с разрешением 7–20 Å. Однако эти картины дифракции, по крайней мере, в 10 раз сложнее тех, с которыми приходилось иметь дело раньше при расшифровке структур несимметричных макромолекул, что сильно затрудняет их интерпретацию. В результате наиболее распространена в настоящее время альтернативная стратегия определения структуры рибосом "по частям": через пространственные структуры индивидуальных рибосомных белков, субдоменов рРНК и их небольших комплексов. Выявленное в ходе этих исследований большое разнообразие пространственных структур рибосомных белков указывает на существование не менее разнообразных механизмов распознавания белками специфических участков РНК, количество которых должно значительно превышать ограниченное число известных механизмов ДНК–белкового узнавания.

Другим плодотворным направлением исследования пространственной структуры рибосом при низком разрешении является электронная микроскопия (ЭМ). При этом образцы с рибосомами быстро замораживают в жидком этане в тонком слое буфера и исследуют с помощью ЭМ при температуре жидкого азота и низких дозах облучения для сохранения чувствительных к радиации структур в интактном состоянии. На получаемых в результате микрофотографиях могут одновременно содержаться сотни и тысячи по-разному ориентированных индивидуальных рибосом, изображения которых далее подвергаются компьютерному анализу с последующей реконструкцией трехмерной структуры индивидуальной рибосомной частицы. Реконструкцию трехмерных структур работающих рибосом получают в результате анализа микрофотографий ультратонких срезов отдельных бактериальных клеток, активно синтезировавших белок или находившихся в состоянии блока трансляции. Одной из разновидностей ЭМ, активно использующейся для исследования пространственной структуры рибосом, является иммуноэлектронная микроскопия. Первичные и пространственные структуры рибосомных белков, формирующие их эпитопы, значительно различаются, поэтому такие белки редко дают перекрестные иммунологические реакции и их можно четко идентифицировать с помощью специфических антител. При анализе комплексов антител с рибосомами с помощью электронной микроскопии можно видеть, что многие белки локализованы на поверхности рибосомных субчастиц. Оказалось, что пространственное расположение большинства рибосомных белков весьма консервативно. В частности, у грамположительных и грамотрицательных бактерий гомологичные белки занимают одни и те же места на поверхности рибосомных субчастиц.

Важная информация о расположении индивидуальных рибосомных белков в составе рибосом получена и с помощью метода поперечных сшивок. Используя бифункциональные реагенты, например диэпоксибутан или 2-иминотиолан, осуществляют ковалентное соединение рибосомных белков, расположенных по соседству на расстоянии 5–10 Å друг от друга. Поскольку в настоящее время аминокислотные последовательности всех рибосомных белков известны, этим методом можно однозначно определять, какие аминокислотные остатки в соседних белках участвуют в образовании поперечных сшивок.

Целостность рибосом в водных растворах в значительной степени зависит от температуры и ионных условий, особенно от концентрации двухвалентных ионов (Mg2+ и Ca2+). Понижение концентрации ионов Mg2+ приводит вначале к диссоциации рибосом на большую и малую субчастицы, а затем к последовательному упорядоченному освобождению рибосомных белков из субчастиц вплоть до их полного распада с образованием пула отдельных белков и рРНК. Процесс разборки рибосом обратим, и при восстановлении ионных и температурных условий в реакционной смеси возможно реконструирование рибосомных субчастиц из отдельных компонентов с образованием полноценных функционально активных рибосом. На рис. I.17 представлена карта сборки большой субчастицы рибосом E. coli из отдельных компонентов, которая отражает последовательность присоединения рибосомных белков к рРНК, а также два основных этапа сборки. Для перехода ко второму этапу необходимо дальнейшее изменение ионных условий и температуры реакционной среды. Процесс сборки субчастиц рибосом является кооперативным, т.е. присоединение одних рибосомных белков стимулирует включение других. При этом белки, включающиеся в состав рибосомных субчастиц друг за другом, в зрелых субчастицах оказываются расположенными рядом. Реконструирование рибосом из отдельных компонентов in vitro внесло большой вклад в понимание пространственной организации рибосомных субчастиц и функциональной значимости отдельных рибосомных белков.

Метод рассеяния нейтронов на протонах, входящих в состав белков, также способствовал пониманию пространственного расположения белков в рибосомах. Отклонения нейтронов после контактов с протонами белков можно легко отличить от отклонений, которые являются результатом взаимодействия нейтронов с другими атомами, в частности тяжелыми изотопами водорода (2H или 3Н). Если в состав дейтерированных рибосомных субчастиц ввести два рибосомных белка, содержащих обычные протоны, то по рассеянию нейтронов на протонах, характер которого значительно отличается от такового на дейтронах, можно определить расстояния между центрами масс этих двух белков. Усовершенствованный метод нейтронного рассеяния позволяет определять не только расстояния между рибосомными белками, но и пространственную организацию самих полипептидных цепей в составе рибосомных субчастиц. Полученные таким образом нейтронные карты основаны на измерении расстояний между 93 белками. Такие карты имеют фундаментальное значение в интерпретации экспериментальных данных, полученных другими методами, особенно в результате молекулярного моделирования.

При отсутствии данных рентгеноструктурного анализа высокого разрешения молекулярные биологи традиционно обращаются к молекулярному моделированию пространственных структур. В некоторых случаях такой подход бывает весьма успешным, что особенно ярко проявилось при расшифровке пространственной структуры ДНК. Все модели, описанные в настоящее время, учитывают филогенетические особенности вторичной структуры 16S рРНК, и в некоторых из них принимаются во внимание третичные взаимодействия внутри этих макромолекул. В последнее время для таких целей все чаще используется компьютерный анализ. Применение вычислительной техники сводит к минимуму субъективизм в построении моделей и позволяет систематически исследовать возможные конформационные состояния анализируемых молекулярных объектов. При этом выбор конкретного алгоритма в современном моделировании оказывает меньшее влияние на конечный результат, чем выбор имеющихся экспериментальных данных и использование ограничивающих условий.

На рис. I.18 представлена современная модель пространственной структуры 70S рибосомы E. coli, разработанная в лаборатории Д. Франка (США) с учетом данных, которые были получены с помощью всех вышеперечисленных методов.

  1.  Этапы биосинтеза белка

Хотя построение первых моделей механизмов биосинтеза белка было начато еще в начале 1960-х гг., полное описание процесса трансляции далеко до завершения и в настоящее время. Ниже будут кратко рассмотрены основные черты классической модели биосинтеза белка рибосомами E. coli, а также особенности некоторых альтернативных моделей.

Процесс биосинтеза белка рибосомами, как и биосинтез любой другой макромолекулы клетки, условно разделяют на три основных этапа: инициацию, элонгацию и терминацию. Во время инициации трансляции происходит сборка нативной 70S или 80S рибосомы на транслируемой мРНК и подготовка к образованию пептидной связи между первыми двумя N-концевыми аминокислотными остатками синтезируемого полипептида. При элонгации наблюдается последовательное удлинение растущей цепи полипептида аминокислотными остатками, а терминация трансляции сопровождается прекращением синтеза полипептида и его высвобождением из трансляционного комплекса. При этом наблюдается также разделение рибосомы и мРНК, после чего они вступают в новый цикл трансляции. В ходе трансляции рибосома последовательно перемещается вдоль транслируемой молекулы мРНК, считывая заключенную в ней генетическую информацию в виде триплетного генетического кода. Трансляция начинается в 5’-концевой части мРНК, а завершается в ее 3’-концевой части. При этом биосинтез полипептида начинается с его N-концевой аминокислоты. Рассмотрим каждый из вышеперечисленных этапов более подробно на примере белоксинтезирующей системы E. coli.

Инициация трансляции. Биосинтез белка рибосомами начинается с образования комплекса между малой 30S субчастицей рибосом, инициаторной тРНК и участком транслируемой мРНК, содержащим сайт связывания рибосом, который включает в себя инициирующий (как правило, AUG) кодон. В образовании инициационного комплекса с 30S субчастицей принимают участие три белковых фактора инициации – IF1, IF2 и IF3. В ходе этого процесса расходуется одна молекула GTP, которая взаимодействует с IF2 и изменяет его конформацию (см. рис. I.19). Таким образом, на первом этапе образования инициационного комплекса происходит объединение свободной 30S субчастицы с факторами инициации и GTP, после чего с ними последовательно связываются мРНК и инициаторная тРНК (в случае E. coli, как правило, формилметионил(fMet)-тРНКfMet). Инициаторная тРНК строго специфична для этой стадии белкового синтеза. Сначала она обычным путем акцептирует Met с образованием Met-тРНКfMet, а затем специальная ферментная система E. coli формилирует NH2-группу остатка Met. Последовательность присоединения инициаторной тРНК и мРНК к 30S субчастице не имеет значения, что и отражено на рис. I.19 (стадии А, А’, В, В’).

Вначале после объединения факторов инициации трансляции, GTP, fMet-тРНКfMet и мРНК с 30S субчастицей антикодон тРНК еще не взаимодействует с инициаторным AUG-кодоном (стадии А’ и B’). Такое продуктивное взаимодействие тРНК с мРНК происходит в дальнейшем (стадия C), и этот переход является одной из лимитирующих стадий всего процесса образования инициационного комплекса. С завершением стадии C происходит формирование стабильного тройного (из трех основных компонентов) инициационного комплекса, сопровождаемое конформационными перестройками всех его компонентов. После выхода из комплекса факторов инициации трансляции IF1 и IF3 тройной комплекс приобретает способность связывать большую 50S субчастицу рибосом, что сопровождается дальнейшими конформационными перестройками всей рибосомы (стадия D). В ходе этого процесса происходит расщепление молекулы GTP до GDP и ортофосфата и освобождение из комплекса фактора IF2 (стадия E). Формилметионил-тРНКfMet вместе с инициирующим AUG-кодоном перемещаются в донорный (P) участок рибосомы, освобождая акцепторный (A) участок для следующей аминоацилированной тРНК. В результате инициационный комплекс становится полностью подготовленным для вступления в следующую фазу биосинтеза белка – элонгацию полипептидных цепей.

Элонгация. В соответствии с обсуждаемой моделью принято считать, что после образования тройного комплекса, включающего 70S рибосому, мРНК и инициаторную тРНК, завершается этап инициации трансляции, и процесс биосинтеза белка вступает в фазу элонгации, которая завершается освобождением полипептидных цепей из элонгирующих комплексов. Во время элонгации происходит последовательное присоединение аминокислотных остатков к C-концевым частям строящихся полипептидных цепей, направляемое кодонами транслируемых матричных РНК.

Этап элонгации начинается со взаимодействия фактора элонгации трансляции EF-Tu, молекулы GTP и очередной аминоацилированной тРНК с A-участком рибосомы (см. рис. I.20, стадия Е1). Вхождение аминоацилированной тРНК в A-участок происходит в соответствии с установленным в нем кодоном транслируемой мРНК. При этом лишь та аминоацилированная тРНК прочно связывается с рибосомой, у которой антикодон комплементарен кодону, установленному в A-участке. После гидролиза GTP и освобождения EF-Tu•GDP из комплекса (стадия Е2) происходит образование новой пептидной связи между карбоксильной группой формилметионина инициаторной тРНК и NH2-группой аминокислотного остатка, находящегося в A-участке рибосомы в составе аминоацил-тРНК (стадия Е3). Эта стадия получила название транспептидации. Обмен GDP на GTP в освободившемся комплексе EF-Tu•GDP происходит с участием фактора EF-Ts.

Образовавшийся в итоге пептид удерживается рибосомой через остаток тРНК, находящийся в A-участке, а освободившаяся тРНК временно сохраняется в так называемом E-участке рибосомы (от англ. exit – выход). Такая соединенная с пептидом тРНК получила название пептидил-тРНК. Образовавшаяся пептидил-тРНК далее переносится из A- в P-участок рибосомы. Эта стадия элонгации (Е4) известна под названием транслокации. Транслокация индуцируется фактором элонгации EF-G, который освобождается из элонгирующего комплекса после расщепления молекулы GTP. Таким образом, энергия еще одной молекулы GTP используется в акте транслокации. После завершения транслокации происходит освобождение фактора EF-G из элонгирующего комплекса. При этом A-участок рибосомы остается свободным. Следующий цикл элонгации начинается с вхождения в A-участок рибосомы в составе тройного комплекса очередной молекулы тРНК (стадия Е1), что сопровождается освобождением формилметионил-тРНКfMet из E-участка, после чего повторяются все остальные вышеперечисленные стадии элонгации. В физиологических условиях рибосома совершает  20 циклов элонгации в секунду. В соответствии с этим для синтеза белка длиной в 200 аминокислотных остатков требуется 10 секунд.

В рассмотренной классической модели биосинтеза белка с тремя участками связывания тРНК на любой стадии элонгации с рибосомой взаимодействуют две молекулы тРНК. Иными словами, до стадии транслокации тРНК занимают A- и P-участки рибосомы, тогда как после транслокации молекулы ассоциированы с P- и E-участками. Между участками A и E существует аллостерическое взаимодействие, что проявляется в отрицательном кооперативном эффекте связывания молекул тРНК этими участками и означает, что только A- или E-участки рибосомы могут быть заняты молекулой тРНК, и рибосома не содержит одновременно занятыми оба участка.

Молекулярная мимикрия фактора элонгации EF-G. Недавно было обнаружено, что пространственная структура домена IV полипептидной цепи фактора элонгации EF-G имитирует структуру тРНК в ее комплексе с другим фактором элонгации EF-Tu. При этом структура соответствующей части полипептидной цепи EF-G напоминает форму антикодоновой петли тРНК в комплексе с фактором элонгации, ее положение относительно кóровой части EF-Tu и даже распределение электростатических зарядов на поверхности полипептида, которое соответствовало таковому углевод-фосфатного остова тРНК. Это открытие позволило по-новому посмотреть на механизм действия EF-G в цикле трансляции. Такого рода данные позволили предположить, что домен IV фактора EF-G занимает во время некоторых этапов транслокации ту же часть A-участка рибосом, что и тРНК. Однако остается непонятным, каким образом это может физически влиять на прохождение акта транслокации.

Терминация трансляции. Процесс трансляции вступает в завершающую фазу после того, как в A-участок рибосомы попадает терминирующий (бессмысленный) кодон мРНК, а пептидил-тРНК перемещается в донорный P-участок рибосомы. Белковые факторы RF1 и RF2 участвуют в распознавании последовательностей нуклеотидов терминирующего кодона. Фактор RF3, также как и EF-G, имитирует структурные особенности фактора EF-Tu, что дает ему возможность взаимодействовать с А-участком рибосомы. Но поскольку с ним не связана аминоацилированная тРНК, его присутствие в А-участке приводит к обрыву строящейся цепи полипептида. После формирования такого комплекса происходит расщепление сложноэфирной связи между полипептидом и тРНК, а также освобождение синтезированного полипептида. С помощью мутационного анализа было установлено, что молекулы рРНК обеих субчастиц рибосом  E. coli участвуют в гидролизе пептидил-тРНК.

Для того чтобы рибосома оставшегося комплекса рибосома–мРНК–тРНК могла вступить в следующий цикл трансляции, она должна освободиться из него. Установлено, что вышеупомянутые рибосомные рилизинг-факторы (RF) совместно с фактором EF-G при участии молекулы GTP обеспечивают диссоциацию комплекса на составные компоненты, которые затем вступают в новый раунд белкового синтеза. Фактор RF4 (иначе называемый RRF – ribosome-recycling factor) не имеет аналога у эукариот. Его роль, по-видимому, заключается в стимуляции перемещения молекулы деацилированной тРНК из P-участка в E-участок рибосомы и(или) удалении оставшегося RF-фактора из A-участка. Это способствует полному освобождению рибосомы и ее вовлечению в новый цикл трансляции в результате инициации или реинициации синтеза белка. Отделившаяся от мРНК рибосома перед вступлением в новый цикл диссоциирует на две субчастицы под действием фактора инициации трансляции IF3. Альтернативно, в том случае, если новый инициирующий кодон полицистронной матрицы находится достаточно близко от стоп-кодона, синтез белка может быть реинициирован.

Реинициация трансляции. Реинициацией трансляции называют повторное вступление рибосом, терминировавших биосинтез белка, в цикл трансляции без предварительного отделения их от мРНК. Реинициация синтеза белка широко распространена у E. coli и играет важную роль в контроле экспрессии генов этого микроорганизма на уровне трансляции. Это связано с тем, что значительная часть бактериальных мРНК полицистронна, а, следовательно, за терминирующим кодоном одного цистрона на небольшом от него удалении располагается инициирующий кодон следующего. Благодаря реинициации имеет место координированная (сопряженная) трансляция нескольких ОРС, объединенных в полицистронной матрице.

Имеются данные о том, что рибосомы E. coli, терминировавшие синтез полипептида, обладают способностью перемещаться на короткие расстояния в окрестностях терминирующего кодона и после встречи с инициирующим кодоном в новом сайте инициации трансляции могут начать следующий раунд трансляции без отделения от мРНК. Новый инициирующий кодон может располагаться выше или ниже стоп-кодона предыдущего гена, а может и перекрываться с ним (например, в последовательности AUGA). Реинициация может происходить с полной эффективностью, если в сайте реинициации имеется адекватная SD-последовательность, а терминирующий и инициирующий кодоны расположены достаточно близко друг к другу (менее эквивалента длины рибосомы). Последнее обстоятельство указывает на быструю кинетику отделения терминировавших рибосом от мРНК.

Важным следствием сопряжения трансляции у прокариот через реинициацию является зависимость экспрессии целой серии генов, принадлежащих одному оперону, от трансляции первой ОРС полицистронной матрицы. При этом следует заметить, что сопряжение экспрессии генов на уровне трансляции может оказывать и негативное влияние на эффективность трансляции нижерасположенных цистронов.

Если обычная инициация трансляции у E. coli на кодоне UUG происходит с очень низкой эффективностью, то реинициирующие рибосомы используют его для начала синтеза белка весьма охотно. Это объясняют отсутствием фактора IF3 в реинициирующем комплексе, который во многом определяет точность выбора инициирующего кодона рибосомами.

На поведение рибосом, терминировавших синтез белка, большое влияние оказывают и факторы терминации трансляции (RF). В опытах с мутантным бактериофагом R17, содержащим амбер-кодон в положении 7 гена белка оболочки, было установлено, что в отсутствие фактора терминации трансляции RF4 вслед за терминацией трансляции на бессмысленном кодоне имела место реинициация трансляции на следующем кодоне мРНК, что завершалось синтезом белка оболочки, укороченного с N-конца на 7 аминокислот. На этом основании полагают, что рилизинг-фактор RF4 в обычных условиях предотвращает распознавание аминоацилированной тРНК кодона, находящегося в А-участке рибосомы, который в мРНК следует за терминирующим.

Альтернативные модели цикла трансляции. В рассмотренной выше классической модели трансляции перемещение молекул тРНК на большой и малой субчастицах рибосом сопряжено друг с другом. В отличие от этого, в активно обсуждающейся модели гибридных состояний (hybrid states model) перемещение тРНК между A- и P-участками 30S субчастицы происходит независимо от перемещения тРНК между A-, P- и E-участками большой субчастицы. В соответствии с этой моделью аминоацил-тРНК попадает в пептидил-тРНК–рибосомный комплекс в составе тройного комплекса EF-TuGTPтРНК и взаимодействует с ней первоначально в гибридном состоянии A/E. В этом состоянии антикодоновая часть тРНК связывается с A-участком 30S субчастицы, а ее CCA-конец, удерживаемый EF-Tu, располагается в E-участке большой субчастицы и, возможно, частично на малой субчастице. Вслед за гидролизом GTP происходит освобождение EF-Tu, что делает возможным перемещение CCA-конца аминоацил-тРНК в A-участок большой субчастицы, приводящее к возникновению A/A-состояния, эквивалентного состоянию взаимодействия аминоацил-тРНК с A-участком в классической модели. После образования пептидной связи аминоацил-тРНК, уже связанная с растущей полипептидной цепью, перемещается в P-участок большой субчастицы, а деацилированная тРНК переходит в E-участок большой субчастицы. Вновь образованная пептидил-тРНК находится теперь в гибридном A/P-состоянии: антикодоновая часть остается в A-участке 30S субчастицы, а CCA-конец занимает P-участок большой субчастицы рибосом. При этом деацилированная тРНК находится в гибридном P/E-состоянии: антикодоновый конец остается в P-участке малой субчастицы, тогда как CCA-конец занимает E-участок большой субчастицы. Далее фактор элонгации EF-G в GTP-зависимой реакции обеспечивает перемещение антикодоновой части тРНК, находящейся в гибридном состоянии, вместе с мРНК относительно 30S субчастицы. При этом пептидил-тРНК переходит в чувствительное к пуромицину P/P-состояние, соответствующее ее взаимодействию с P-участком в классической модели, а деацилированная тРНК находится в E-состоянии и на этом этапе трансляции может взаимодействовать только с E-участком большой субчастицы рибосом.

По крайней мере, три интересных следствия вытекают из модели гибридного состояния. Во-первых, пептидильная часть растущего пептида остается на рибосомах в стационарном состоянии, а во время трансляции перемещается тРНК. Во-вторых, транслокация тРНК происходит в два этапа: во время первой стадии обе молекулы тРНК движутся относительно большой субчастицы, на втором этапе обе молекулы тРНК вместе со связанной с ними мРНК перемещаются относительно малой 30S субчастицы рибосом. В-третьих, в процессе синтеза белка имеют место не два или три состояния связывания тРНК, а шесть или даже, возможно, семь таких состояний.

С помощью физических методов были получены прямые доказательства спонтанного прохождения стадии транслокации, опосредуемой пептидилтрансферазой рибосом. При использовании флуоресцентных зондов, связанных с различными участками тРНК и рибосом, удалось обнаружить изменения в квантовом выходе флуоресценции и анизотропные эффекты при образовании пептидной связи, что указывало на перемещение молекулы тРНК относительно рибосомных белков S21 и L11. На основании этих данных было высказано предположение, что во время пептидилтрансферазной реакции пептидильная цепь остается в постоянном положении относительно рибосомы, а перемещаются молекулы тРНК. Эта модель пептидилтрансферазной реакции получила название модели перемещения (displacement model). Она обладает многими общими чертами с моделью гибридного состояния, однако отличается тем, что в этой модели движение мРНК в пептидилтрансферазной реакции сопровождает перемещение тРНК.

Замечания о точности трансляции. Сама по себе стабильность кодон–антикодоновых взаимодействий не может обеспечивать наблюдаемую высокую точность трансляции. Рибосомы активно участвуют в акте распознавания молекулами тРНК соответствующих кодонов мРНК, повышая точность функционирования этого механизма, по крайней мере, на четыре порядка. Данный эффект объясняют функционированием механизмов, корректирующих ошибки на этом этапе трансляции, которые сопряжены с EF-Tu-зависимым гидролизом GTP во время выбора соответствующей аминоацилированной тРНК. Недавние измерения скорости гидролиза GTP рибосомами в присутствии правильной (cognate) или неправильной (noncognate) тРНК и искусственной матрицы показали, что в первом случае она выше в  104 раз. Это приводит к преимущественному освобождению комплекса EF-TuGDP из рибосом, содержащих правильные аминоацил-тРНК в А-участке. Для реализации данного механизма рибосомы должны распознавать правильные и ошибочные кодон-антикодоновые взаимодействия, а также передавать эту информацию своему GTPазному центру.

Мутантные рибосомы, для которых характерна пониженная точность трансляции, как правило, обладают более высоким сродством к тРНК в A-участке. Напротив, у "сверхточных" рибосом такое сродство понижено. В соответствии с этим повышенную точность трансляции можно объяснять в терминах уменьшения неспецифического связывания аминоацилированных тРНК A-участком рибосом и vice versa. Недавно было показано, что сродство тРНК к P-участку таких мутантных рибосом изменяется на противоположное таковому A-участка: у ram-мутантов с низкой точностью трансляции наблюдается пониженное сродство P-участка к тРНК, а у "сверхточных" рибосом это сродство повышено. Таким образом, в настоящее время полагают, что простые реципрокные отношения связывают A- и P-участки рибосом с механизмами, которые управляют взаимодействием мРНК и соответствующих тРНК с рибосомами.

Новая 10Sa РНК, функционирующая в трансляции. В том случае, если транслируемая бактериальная мРНК укорочена в своей 3’-концевой части и рибосома не находит в соответствующей рамке считывания терминирующий кодон, она не может закончить трансляцию с помощью стандартного механизма терминации. Полагают, что, столкнувшись с такой ситуацией, рибосома останавливается на конце мРНК и с ней взаимодействует недавно открытая 10Sa РНК, кодируемая у E. coli геном ssrA, которая запускает процесс деградации частично синтезированного полипептида. Эта необычная РНК, аминоацилированная остатком Ala на своем 3’-конце, подобном стандартной акцепторной последовательности тРНК, сочетает в себе свойства тРНК и мРНК. 10Sa РНК, как и тРНКAla, образует внутреннюю пару оснований G3:U70, которая необходима для специфического распознавания тРНКAla рибосомами. После взаимодействия с рибосомой эта РНК вступает в стандартный цикл трансляции: ее остаток Ala включается в недостроенную цепь полипептида. Вслед за этим рибосома транслирует короткую последовательность нуклеотидов 10Sa РНК, которая теперь функционирует в качестве матрицы, добавляя десять аминокислот – ANDENYALAA – в C-конец укороченной полипептидной цепи, и терминирует трансляцию на UAA-кодоне 10Sa РНК. C-Концевая олигопептидная последовательность освободившегося полипептида далее распознается специфической протеиназой, которая расщепляет этот полипептид, обеспечивая его утилизацию бактериальной клеткой в процессе катаболизма.

  1.  Антибиотики, действующие на уровне трансляции

На рис. I.21 приведены некоторые широко распространенные антибиотики, являющиеся ингибиторами биосинтеза белка у бактерий. Многие из них находят применение не только как лекарственные средства, но и как превосходные инструменты исследования механизма различных этапов биосинтеза белка. Биохимический анализ мутантов бактерий, устойчивых к действию конкретных антибиотиков, позволяет обнаруживать сайты действия антибиотиков на рибосомах и идентифицировать изменения компонентов системы белкового синтеза под влиянием этих мутаций. Как правило, для возникновения устойчивости к антибиотику достаточно замены одного аминокислотного остатка из 7500 остатков белков, составляющих бактериальную рибосому. То же самое относится и к 4500 основаниям рибосомных РНК. В этом случае не только замены одиночных оснований в рРНК, но и модификация (метилирование) единственного основания могут приводить к подобным эффектам. Рассмотрим механизм действия некоторых антибиотиков более подробно.

Пуромицин. Этот антибиотик представляет собой производное нуклеозидов и является структурным аналогом 3’-концевой аминоацилированной группировки тРНК. Прямыми экспериментами было показано, что пуромицин конкурентным образом замещает очередную аминоацил-тРНК в A-сайте рибосом в процессе трансляции. Он участвует в акте образования пептидной связи в рибосоме, подменяя при этом очередную аминоацил-тРНК. В ходе реакции транспептидации происходит переброска C-конца растущего пептида от пептидил-тРНК на свободную аминогруппу его аминоацильного остатка, что приводит к освобождению пептидил-пуромицина из рибосом и прекращению биосинтеза белка. Пуромицин одинаково хорошо подавляет биосинтез белка как прокариотическими, так и эукариотическими рибосомами.

Хлорамфеникол. Участок лабильного связывания этого антибиотика локализован на 50S субчастице рибосом. Хлорамфеникол полностью ингибирует реакцию пуромицина с пептидил-тРНК, выступая его конкурентным ингибитором. При этом синтез пептида полностью прекращается, и он остается связанным с рибосомами. Предполагают, что хлорамфеникол имитирует аминоацильный конец молекулы аминоацил-тРНК, а его дихлорацетамидная группировка соответствует аминоацилу. Местом действия хлорамфеникола является A-участок 50S субчастицы рибосом, где антибиотик конкурирует с аминоацильным концом молекулы аминоацил-тРНК, препятствуя ее вхождению в A-участок, что сопровождается подавлением биосинтеза белка. В отличие от пуромицина хлорамфеникол ингибирует только бактериальные рибосомы. Сходным механизмом действия обладают антибиотики линкомицин и спарсомицин. Последний делает ассоциацию пептидил-тРНК с P-участком рибосом более прочной. При этом хлорамфеникол и линкомицин способны вытеснять спарсомицин из его комплекса с рибосомами.

Фусидовая кислота – антибиотик стероидной природы, блокирует биосинтез белка на стадии транслокации. Его мишенью является не столько сама рибосома, сколько белковый фактор EF2(EF-G), который, как указывалось выше, необходим для GTP-зависимой транслокации. Фусидовая кислота не влияет на взаимодействие фактора EF2(EF-G) и GTP с пре-транслоцированной рибосомой и последующее расщепление GTP. По-видимому, антибиотик препятствует диссоциации указанного комплекса и сопряженной с ней транслокации. По тому же механизму фусидовая кислота подавляет трансляцию эукариотическими рибосомами.

Тетрациклины. Антибиотики тетрациклинового ряда специфически связываются с 30S субчастицей рибосом, подавляя реакцию аминоацил-тРНК с рибосомами и свободными 30S субчастицами в присутствии матрицы, но не нарушая связывание самого матричного полинуклеотида. Предполагают, что тетрациклины взаимодействуют с акцепторным тРНК-связывающим участком 30S субчастицы рибосом.

Стрептомицин и другие аминогликозидные антибиотики. Стрептомицин (антибиотик углеводной природы) специфически взаимодействует с определенным структурным белком 30S субчастицы рибосом, блокируя стадию инициации трансляции. В присутствии стрептомицина наблюдается стимуляция связывания аминоацил-тРНК, не соответствующих кодонам мРНК, находящимся в данный момент в акцепторном A-участке рибосом. В итоге происходит ошибочное включение аминокислот в полипептидные цепи синтезируемых белков. Это может проявляться в фенотипической супрессии нонсенс-мутаций у мутантных бактерий. Аминогликозидные антибиотики также вызывают неспецифическое связывание матричных полинуклеотидов рибосомами. Следствием является, например трансляция одноцепочечных ДНК рибосомами в бесклеточных системах в присутствии аминогликозидов.

  1.  Трансляция у эукариот

Бактерии обладают единственной универсальной системой трансляции, основные механизмы функционирования которой были кратко рассмотрены выше. В отличие от этого, клетки животных кроме основной системы трансляции, локализованной в цитоплазме, имеют дополнительную систему трансляции митохондрий, которая по ряду свойств приближается к бактериальной. Клетки растений обладают еще одной дополнительной системой биосинтеза белка, функционирующей в хлоропластах. Большинство данных о механизмах биосинтеза белка у эукариот было получено с использованием бесклеточных белоксинтезирующих систем (подробнее о принципах функционирования таких систем см. в разделе 7.4). В последнее время важные результаты о механизмах трансляции у эукариот были получены с использованием стабильно трансформированных клеток животных и растений, выращиваемых в культуре. В ходе этих исследований установлено, что у растений и животных в основном функционируют одни и те же механизмы трансляции. Ниже будут рассмотрены основные молекулярные механизмы, участвующие в трансляции мРНК у эукариот, с привлечением данных, полученных главным образом на дрожжах S. cerevisiae.

  1.  Особенности первичной структуры эукариотических мРНК

Зрелая мРНК эукариот наряду с основной последовательностью нуклеотидов, в которой закодирована информация о последовательности аминокислот в соответствующем белке, содержит целый ряд некодирующих последовательностей, присутствие которых исключительно важно для ее эффективной, регулируемой трансляции рибосомами. Одни из этих последовате