23444

Современные методы индикации и идентификации B.anthracis

Книга

Биология и генетика

В Центре по контролю за заболеваемостью США разработали оптимизировали и оценили ферментносвязанный иммуносорбентный анализ ELISA на IgG антитела к защитному антигену PA Bacillus anthracis в сыворотке человека. Identification of Bacillus anthracis by a sample protective antigenspecific mAb dotELISA. Detection of frequency resonance energy transfer pair on doublelabeled microsphere and Bacillus anthracis spores by flow cytometry. anthracis лабораторной службы США.

Русский

2013-08-05

98 KB

1 чел.

Современные методы индикации и  идентификации B.anthracis.

(Краткий обзор публикаций за 2003-1999годы)

Лобанова Т.П., Кихтенко Н.В.

Применение спор сибирской язвы в качестве биологического оружия обусловлено относительной легкостью получения большого количества биологического материала, возможностью его скрытного применения, высокой эффективностью. Наиболее эффективный способ применения сибирской язвы в виде бактериологического оружия - распыление аэрозоля, содержащего жизнеспособные споры возбудителя. В связи с этим среди пораженных будут преобладать пациенты с легочной формой болезни, сопровождающейся высокой летальностью.

По оценкам экспертов на сегодняшний день как минимум 17 стран или уже располагают готовым биологическим оружием, или завершают разработки в этой области.( Dhawan B., Desikan-Trivedi P., Chaudhry R., Narang P. Bioterrorism: a threat for which we are ill prepared. Natl Med J India 2001; 14:225-30).

Заражение людей сибирской язвой, связанное с ингаляционным путем поступления возбудителя в организм, описано также как результат аварийных ситуаций в специальных лабораториях, занимающихся разработкой биологического оружия. (Сибирская язва. Ю.В. Лобзин, В.М. Волжанин, С.М. Захаренко. http://www.iacmac.ru/cmac/2002_4_2/full/104_text.htm). 

Основными в диагностике ингаляционной формы сибирской язвы до последнего времени оставались традиционные методы микробиологического исследования. На более поздних стадиях болезни при отсутствии лечения количество возбудителя в крови, как правило, велико, в связи с чем он может обнаруживаться при микроскопии нативных мазков крови, окрашенных по Граму. В то же время с учетом отсутствия истинного пневмонического процесса обнаружение возбудителя при окраске по Граму и культуральном исследовании мокроты маловероятно.

Наиболее ценным диагностическим тестом, подтверждающим диагноз ингаляционной формы сибирской  язвы, остается культуральное исследование крови, при котором рост возбудителя обнаруживается через 6-24 ч. При  готовности  лаборатории к возможному поступлению материала от пациентов с сибирской язвой, проведение биохимических тестов и определение морфологии возбудителя позволяют дать предварительный ответ уже в течение 12-24 ч.

(http://www.iacmac.ru/cmac/2002_4_2/full/104_text.htm ).

Связанная с биотерроризмом эпидемия сибирской язвы среди людей осенью 2002 года подчеркнула необходимость разработки чувствительного, воспроизводимого, скоростного лабораторного теста для подтверждения диагноза «сибирская язва» у человека.

Иммуноферментный анализ (ИФА), традиционно используемый для определения IgG-антител к протективному антигену B.anthracis, является высокочувствительным (98,6%) методом, однако специфичность его составляет около 80%. Для повышения специфичности в качестве второго подтверждающего этапа используется ИФА с конкурентным ингибированием протективного антигена. Исследования показывают, что специфические IgG-антитела к протективному антигену определяются уже на 10-е сутки от начала болезни, в то время как максимальная концентрация антител может не развиваться в крови вплоть до 40-х суток. (Turnbull P.C.B., Doganay M., Lindeque P.M., et al. Serology and anthrax in humans, livestock and Etosha National Park wildlife. Epidemiol Infect. 1992; 108:299-313.).

В России разработан диагностический набор для постановки иммуноферментного твердофазного «сэндвич»-анализа, позволяющего идентифицировать возбудителя сибирской язвы и дифференцировать его от родственных видов спорообразующих бацилл. Метод превосходит по чувствительности прямой иммуноферментный  в 50-100 раз, реакцию торможения непрямой гемагглютинации – в 100-200 раз, реакцию диффузионной преципитации – в 500-1000 раз (Николайчук Л.Ф., Вишняков И.Ф., Бакулов И.А., Котляров В.М., Бударкова Э.Л. Индикация спор возбудителя сибирской язвы в объектах внешней среды и кормах иммуноферментным методом./В кн.:Диагностика, профилактика и меры борьбы с особо опасными и экзотическими болезнями животных. Покров.1998.-с.329-330.)

Разработан быстрый метод для обнаружения протективного антигена в крови, сыворотке и других жидкостях организма у инфицированных животных и человека с использованием иммунохроматографической мембраны. Антиген улавливается моноклональными антителами, связанными с нитроцеллюлозной мембраной, а вторые моноклональные антитела, специфичные к различным эпитопам, связанные с частицами коллоидного золота, являются реагентами для его детекции. Для проведения реакции требуется 10 минут, наименьшее количество антигена, обнаруживаемого за одну стадию, равняется 25 нг\мл. При оценке панели положительных и отрицательных сывороток подтверждена высокая чувствительность метода и его 100% специфичность при концентрации мишени 25 нг\мл. По чувствительности этот метод сопоставим с методом ELISA при использовании одинаковых реагентов, но последний требует для проведения 4 часа. (Пальцев M.A. Молекулярная медицина и прогресс фундаментальных наук // Вестник РАН. 2003,т.73, №2,с.99-109). 

В Центре по контролю за заболеваемостью США разработали, оптимизировали и оценили ферментно-связанный иммуносорбентный анализ (ELISA) на IgG антитела к защитному антигену (PA) Bacillus anthracis в сыворотке человека. Квалифицированный ELISA имеет минимальный уровень выявления 0,06 мкг/мл, достоверный нижний предел выявления 0,09 мкг/мл, нижний предел количественного определения в неразбавленных образцах сыворотки 3,0 мкг/мл IgG к защитному антигену. Диагностическая чувствительность анализа составляет 97,8%, диагностическая специфичность – 97,6%. С целью повышения диагностической специфичности до 100% был также разработан конкурентный ингибирующий ELISA на IgG к защитному антигену. Эти анализы оказались полезными для подтверждения случаев сибирской язвы как при кожном, так  и при ингаляционном заражении, а также при  обследовании пациентов с подозрением на сибирскую язву. (C.P.Quinn, V.A.Semenova, Ch.M.Elie et al. Specific, sensitive, and quantitative enzyme-linked immunosorbent assay for human immunoglobulin G antibodies to Anthrax toxin protective antigen. Emerg. Infect. Dis., 2002,v.8,n.10,p.1103-1111).

В Индии разработан метод дот-ELISA для системы протективный антиген (РА)- реактивные моноАТ.  Протективный АГ выделяют на среде с казаминовыми кислотами, среду кипятят для инактивации клеток и супернатант используют в дот-ELISA. Из 27 подозрительных проб от пациентов 24 оказались положительными, что в дальнейшем подтвердилось ПЦР. (K.S.R.Sastry, U.Tuteja, P.K.Santhosh et al. Identification of Bacillus anthracis by a sample protective antigen-specific mAb dot-ELISA. J.Med.Microbiol.,2003,v.52,p.47-49).

В Израиле комбинируют проточную цитометрию и FRET-мечение. Проточная цитометрия– высокоселективный и высокочувствительный метод. FRET(частотный резонансный энергетический перенос)-эффект  для снижения шума (фона) адаптируют к иммунофлюоресцентному методу. Флюоресцентно меченый авидин и биотиновые бусы – как модельная система. Намеченная цель – меченые поликлональные АТ к спорам сибирской язвы. Использованы кроличьи IgG против экзоспоровых компонентов возбудителя сибирской язвы, помеченные донор-акцепторной хромофорной парой alexa488 и alexa 594. В проточной цитометрии анализировали комплексы споры-IgG. Споры Bac.anthracis отличались от спор других видов Bacillus.(Zahavy E, Fisher M, Bromberg A, Olshevsky U. Detection of frequency resonance energy transfer pair on double-labeled microsphere and Bacillus anthracis spores by flow cytometry.Appl.Environ.Microbiol.,2003,v.69,n.4,p.2330-9).

Для практических работников не вызывает затруднений идентификация вирулентных капсульных штаммов: они однотипны независимо от источника выделения, характеризуются лишь небольшими отличиями. Проблему представляет идентификация полевых бескапсульных штаммов, обладающих слабой вирулентностью для мышей, морских свинок, а также дифференциация их от Bac.cereus, патогенных для людей и лабораторных животных. С этой целью используются методы молекулярной биологии. В качестве дополнительного теста ПЦР-анализ включен в общую схему идентификации В. anthracis лабораторной службы США. Для исследования используют тест-систему с праймерами к генам протективного антигена и капсулообразования. Дополнительно для штаммов с отсутствием обеих собственных плазмид рекомендована тест-система с праймерами, специфичными к хромосомным генам, кодирующим S-слой. Следует обратить внимание на  американскую стратегию: практические лаборатории снабжаются  всеми необходимыми компонентами для генотипирования в короткий срок в полевых условиях выделенных штаммов и быстрой расшифровки эпизоотии. (Бакулов И.А., Гаврилов В.А., Селиверстов В.В. Сибирская язва (антракс). Новые страницы в изучении старой болезни. «Посад» Владимир. 2001).

В настоящее время предложены различные модификации ПЦР, позволяющие существенно повысить эффективность анализа. Разработаны тест-системы для детекции В. anthracis с помощью ПЦР в реальном времени. Предложены различные схемы ПЦР-анализа. Описаны варианты как монолокусной  так и мультилокусной ПЦР.

Известно, что вирулентные изоляты сибирской язвы содержат две плазмиды (pX01 и pX02) с уникальными мишенями, которые позволяют идентифицировать сибирскую язву методом ПЦР. В Центре по контролю за болезнями США разработан скоростной (rapid-cycle) real-time PCR с использованием LightCycler. Созданы  праймеры  и зонды для идентификации как протективного антигена (плазмида pX01), так и инкапсулярного В протеина (плазмида рХ02). Метод (амплификация и анализ продуктов) занимает менее 1 часа. Ген протективного антигена определяется в 29 из 29 вирулентных штаммов, ген капсулярного белка В – в 28 из 29 тех же штаммов. Три авирулентных штамма содержат только одну из плазмид и, соответственно, только один из генов  может быть детектирован  в этих образцах. Метод специфичен для сибирской язвы:  негативные образцы не определяются. Аналитическая специфичность – 1 копия на 1 мкл пробы. Метод пригоден для быстрой идентификации культуральных изолятов и требует доработки для идентификации образцов, выделенных от людей. (C.A.Bell, J.R.Uhl, T.L.Hadfield et al. Detection of Bacillus anthracisDNA by LightCycler PCR. J.Clin.Microbiol.,2002,v.40,n.8,p.2897-2902).

В Великобритании  (Портон Даун) разработан скоростной метод ПЦР для определения сибирской язвы. Утверждается, что цепь-специфичное (strand-specific) определение ампликонов  в течение 10мин реально при использовании метода флюоресценции в пробирке (fluorescent in-tube). Использовали LightCycler,  увеличили скорость и специфичность, ввели систему внутреннего контроля ПЦР. (M.A.Lee, G.Brightwell, D.Leslie et al. Fluorescent detection techniques for real-time multiplex strand specific detection of Bac. Anthracis using rapid PCR. J.Appl.Microbiol.,1999,v.87.p.218-223; G.Brightwell, M.Pearce, D.Leslie. Development of internal controls for PCR detection of Bac.anthracis. Mol.Cell Probes,1999,v.12,n.6,p367-377).


В Институте Р.Коха в Германии выполнено исследование TaqMan Real-timer PCR:   бактерии сибирской язвы, взятые уколом с отдельной колонии или клеточного осадка культуральной жидкости вносят сразу в ПЦР-смесь, минуя стадию выделения ДНК и снижая, таким образом, риск заражения. Метод занимает 2-3 часа. Используется прямая инокуляция колонии или клеточного осадка в ПЦР-реакцию. (Ellerbrok H, Nattermann H, Ozel M, Beutin L, Appel B, Pauli G. Rapid and sensitive identification of pathogenic and apathogenic Bacillus anthracis by real-time PCR. FEMS Microbiol Lett. 2002,v.214,n.1,p.51-9).


Метод
real-tymer PCR адаптирован для быстрой детекции спор сибирской язвы в смывах из носоглотки и ран. Определяли три различных штамма, клинически изолированных с 1960 по 1970 годы от пациентов с кожными язвами. Для амплификации использовали праймеры  rpoBF1a  (CCACCAACAGTAGAAAATGCC) и rpoBR1a (AAATTTCACCAGTTTCTGGATCT) (2) и флюоресцентные зонды (BaP1, TCCAA AGCGCTATGATTTAGCAAATGT fluorescein; BaP2, Red 40-GGTCGCTACAAGATCAACAAGTTACAC-P, where P indicates  phosphorylation at the 3_ end) для детекции ампликонов. Метод позволяет определить 25 спор\мл за 90 мин, включая время для приготовления ДНК экстрактов. Видоспецифичность обусловлена выбором праймеров. Наблюдается линейная корреляция между концентрацией ДНК-мишени и соответствующими точками скрещивания (количеством циклов при начале линейной фазы). Метод хорошо воспроизводится (коэффициент вариации 1,34%). Материал в реакцию вносится в виде бойлингов (прокипяченых образцов)  (L.Drage, A.Lombardi, E.de Vecchi, M.R.Gismendo.Real-Time PCR Assay for Rapid Detection of Bacillus anthracisSpores in Clinical Samples. J. Clin.Microbiol.,. 2002, v. 40, No. 11, p. 4399).

Для определения сибирской язвы у пациентов и в образцах развили 3 отдельных PCR-метода с использованием флюоресценции (FRET) для детекции pXO1, pXO2 плазмид и хромосомных маркеров. Использовали  3 разных набора праймеров и флюоресцентных зондов. В зонд, кроме флюоресцентой метки, добавлен Су5, что усиливало флюоресценцию. Использовали LightCycler LC24. Медоты специфичны и применимы при 25нг общей ДНК в пробе или грубом клеточном экстракте со свежей колонии. Генотип  штаммов B.anthracis определяется менее чем за 1 час. (G.Patra, L.E.Williams, Y.Qi et al. Rapid genotyping of Bac.anthracis strains by real-times PCR. Ann.N.Y.Acad.Sci.,2002,v.969,p.106-111).


В Италии разработан протокол массовой проверки для выявления сибирской язвы в носоглоточных мазках на основе этапа обогащения в жидкой среде. Инкубирование с целью выращивания проводилось в автоклавных пробирках и штативах, что позволяет проводить анализ стерилизуемых культур в реальном времени. Двухцветная ПЦР регулировалась с помощью праймеров и зондов для хромосомного маркера rpoB и плазмидного маркера lef. Специфические наборы праймеров и зондов были предназначены для дифференциации Bacillus anthracis от B. cereus и для дифференциации вакцинного штамма Sterne от полевых изолятов и штамма Ames, который использовался во время недавней биотеррористической атаки с применением сибирской язвы. Таким образом, данный протокол сочетает высокую специфичность и чувствительность ПЦР реального времени с отличной биобезопасностью и непродолжительным временем, необходимым для обработки больших количество образцов, что крайне важно во время выполнения контрольных программ, включающих обработку больших количеств образцов. . (M.R.Oggioni, F.Meacci, A.Carattoli et al. Protocol for Real-Time PCR identification of Anthrax Spores from nasal swabs after broth Enrichment. J.Clin.Microbiol.,2002,v.40,n.11,p.3956-3963).

Показано, что тепловая инактивация материала перед ПЦР на 121С в течение 45 мин практически не влияет на результат реакции. (A.Fasanella, S.Losito, R.Adone et al. PCR assay to detect Bac.anthracis spores in heat-treated specimens. J.Clin.Microbiol.,2003,v.41,n.2,p.896-899).

Разработан метод, позволяющий  определить Bac.anthrax  в образцах, обработанных формалином и залитых парафином, и даже от пациентов, прошедших курс антибиотикотерапии. ПЦР с увеличенными циклами, либо ПЦР образец в качестве повторной матрицы. (S.M.Levine, G.Perez-Perez, A.Olivares et al. PCR-based detection of Bac.Anthracis in formalin-fixed tissue from a patient receiving ciprofloxacin. J.Clin.Microbiol.,2002,v.40,n.11,p.4360-4362).

В Японии разработан метод  определения  спор возбудителя сибирской язвы  в атмосфере. Показано, что единичная клетка может быть обнаружена в течение 1 часа при использовании real-time PCR в Light Cycler системе и в течение 2 дней на селективном агаре. (Makino SI, Cheun HI, Watarai M, Uchida I, Takeshi K. Detection of anthrax spores from the air by real-time PCR. Lett Appl Microbiol., 2001,v. 33,n.3,p.237-40; Makino S, Cheun HI. Application of the real-time PCR for the detection of airborne microbial pathogens in reference to the anthrax spores.
J.Microbiol.Methods.,2003,v.53,n.2,p.141-7).

 Для определения животных с латентной формой сибирской язвы и проверки  мяса разработан метод Нестед-ПЦР, позволяющий обнаружить одну бактерию в 1 г ткани (мяса) и изолировать на селективном агаре морфологически в течение 2 дней.(Cheun HI, Makino SI, Watarai M, Shirahata T, Uchida I, Takeshi K. A simple and sensitive detection system for Bacillus anthracis in meat and tissue. J. Appl. Microbiol. 2001,v.91,n.3,p.421-6).

В Германии разработан  метод ПЦР-ELISA для определения возбудителя сибирской язвы в твердых образцах. Используют микротитровальные планшеты, покрытые стрептавидином , и планшеты с ковалентносвязанными  олигонуклеотидами. Чувствительность теста – 10fg (фг) чистой геномной ДНК или 10 спор, высеянных на 100г твердого материала. (W.Beyer, S.Pocivalsek, R.Bohm. Polymerase chain reaction-ELISA to detect Bacillus anthracis from soil amples-limitations of present published primers. J.Appl.Microbiol.1999,v.87,n.2,p.229-36).

В Великобритании опубликованы результаты исследования по определению спор сибирской язвы на коммерческих волокнах (шерсть и кашемир). Механическое выделение спор на бусах после измельчения волокон в один шаг. НестедПЦР. (Levi K, Higham JL, Coates D, Hamlyn PF. Molecular detection of anthrax spores on animal fibres. Lett. Appl. Microbiol. 2003,v.36,n.6,p.418-22).

Сообщается о разработке метода быстрой подготовки образцов ДНК для детекции спор (чувствительность <10 спор в образце). (Luna VA, King D, Davis C, Rycerz T, Ewert M, Cannons A, Amuso P, Cattani J. Novel sample preparation method for safe and rapid detection of Bacillus anthracis spores in environmental powders and nasal swabs. J.Clin.Microbiol. 2003,v.41,n.3p.1252-5).

Сообщается о трех коммерческих тестах для прямого определения спор сибирской язвы. (King D, Luna V, Cannons A, Cattani J, Amuso P. Performance assessment of three commercial assays for direct detection of Bacillus anthracis spores. J.Clin. Microbiol.,2003,v.41,n.7,p.3454-5).

Систематическая эволюция лигандов экспоненциальным обогащением (SELEX) использована для селекции и ПЦР-амплификации последовательностей (аптамеров), способных связываться и детектировать споры непатогенного штамма Sterne сибирской язвы. Использовали метод простого аффинного разделения, в котором автоклавированные споры использовали как матрицу. Для детекции спор приспособили метод аптамер-магнитных бус-электрохемилюминисцентного метода (AM-ECL). Используя низкое SELEX соотношение  ДНК-споры (154нг ДНК\10 (6)спор), методом AM-ECL определили по крайней мере три различных популяции одноцепочечных ДНК-аптпмеров, имеющих разную аффинность к спорам сибирской язвы. Определили споровые компоненты в пределах от <10 до  > 6x10(6) спор. При низком соотношении ДНК\споры , аптамеры можно высвободить из спорового осадка нагреванием до 96С в течение 5 мин после каждого раунда SELEX. При более высоком соотношении (10,256 нгДНК\10(6)спор) была проведена адаптация метода и использовали сет высокоаффинных аптамеров, которые оставались связанными даже при нагревании по 5 мин до 99С после каждого раунда SELEX. Однако эти аптамеры определялись по связыванию их 5’-биотинилированных концов меченым авидином и могли быть элюированы деионизованной водой. Аптамеры потенциально можно использовать как недорогой , in vitro генерируемый рецептор для биосенсоров. (J.G.Bruno, J.L.Kiel.  In vitro selection of DNA aptamers to anthrax spores with electrochemiluminescence detection. Biosens.Bioelectron. 1999,v.14,n.5,p.457-64.).

Особый интерес представляют макромолекулы, обнаруженные в B. anthracis, которые являются (1) споро-специфичными, (2) легкодоступными на  поверхности спор и (3) отличными от присутствующих в родственном микроорганизме. Один из немногих биохимических методов идентификации спор B. anthracis основан на присутствии рамнозы и 3-О-метилрамнозы, что определяется газовой хроматографией – массовой спектрометрией. Родственные микроорганизмы содержат, кроме того, 2-О-метилрамнозу и фукозу. Рассматриваются углеводороды и гликопротеины микроорганизмов группы B. cereus и родственной группы B. subtilis. Существует гипотеза, что споро-специфический углеводород является компонентом недавно описанного гликопротеина экзоспория B. anthracis. Дальнейшая работа по определению белковых и углеводородных компонентов B. anthracis могла бы во многом способствовать разработке новых технологий быстрой биодиагностики. (A.Fox, G.C.Stewart, L.N.Waller et al.Carbohydrates andglycoproteins of Bac.anthracis and related bacilli: targets for biodetection. J.Microbiol.Methods,2003,v.54,p.143-152). 

Фаговый дисплей. Для просмотра живых нативных спор, суспедированных в растворе, использовали нативную человеческую одноцепочечную Fv (scFv) фаговодисплейную библиотеку. Прямое in vitro сканирование и ELISA селекция дали панель из 9 scFv клонов, из которых два, 5В и 7Е, отобрали для дальнейшего исследования. Эти два клона отличались от других их относительной специфичностью и аффинностью  к спорам B.subtilis IFO3336 против панели спор 11 других видов Bacillus. Различные иммуноферментные протоколы показали, что эти клоны узнают различные споровые эпитопы. Интересно, что, как показало антител-фаговое связываение, некоторые споровые эпитопы заметно отличались в свободном и иммобилизованном состоянии. Процедура дополнительной селекции библиотеки – конструирование шаффл-подбиблиотеки Fab-цепей 9 отобранных клонов и использование  субтрактивной (исключающей) стратегии для удаления кроссреактивности с B.licheniformis 5A24. Также создан метод для прямой детекции индивидуальных спор, используя флюоресцентное мечение антитела-фага. Описанная стратегия дает основу для обнаружения человеческих антител к нативным спорам B.anthracis, которые могут быть использованы как диагностические и терапевтические реагенты. (B.Zhou, P.Wirsching, K.Janda. Human antibodies against spores of the genus Bacillus: A model study for detection of and protection against anthrax and the bioterrorist threat. PNAS,2002,v.99,n.8,p.5241-5246).

Биологические микрочипы — совершенно новое направление современной аналитической биологии и медицины. В 1999 г. на основании данных о различиях в структуре 16S и 23S рибосомальной РНК разработан микрочип, способный улавливать отличия в одну пару оснований в 16S рРНК и дифференцировать как виды,  так и штаммы группы В. cereus. При этом только 2 из 40  штаммов других представителей группы имели последовательности 16S рРНК, идентичные В.antrhracis, но их можно было отличить от сибиреязвенного микроба на основании анализа последовательностей 23S рРНК. (В.В.Кутырев, Н.И.Смирнова. Генодиагностика и молекулярное типирование возбудителей чумы, холеры и сибирской язвы. Мол.ген.микробиол.вирусол.2003,№1,с.6-14).

В современных условиях угрозы биотерроризма микрочиповая технология имеет перспективу применения  в виде портативных устройств для быстрого обнаружения микроорганизма и мониторинга внешней среды. Предложен способ индикации, состоящий в использовании миниатюрного ультразвукового дезинтегратора со специальным картриджем для лизиса, разрушающего споры в течение 30 секунд, с последующим быстрым анализом в реальном времени на ПЦР-микрочипе. Для извлечения ДНК из спор  используют минисоникатор. Общее время извлечения и анализа ДНК, используя минисоникатор и микрочип для ПЦР, составляет 15 мин. (Belgrader P, Hansford D, Kovacs GT, Venkateswaran K, Mariella R Jr, Milanovich F, Nasarabadi S, Okuzumi M, Pourahmadi F, Northrup MA. A minisonicator to rapidly disrupt bacterial spores for DNA analysis. Anal.Chem., 1999,v.71,n.19,p.4232-6).

В России разработан МАГИК-чип (матрица гель-иммобилизованных компонентов на микрочипе), который состоит из массива гидрофильных  ячеек гидрогеля, закрепленных на гидрофобной поверхности стекла. Основные манипуляции, необходимые для анализа нуклеиновых последовательностей (ПЦР, отделение праймеров и продуктов  амплификации от субстрата, гибридизация, лигирование  и т. д.), могут быть проведены в ячейках чипа. В МАГИК-чипе для обнаружения В. anthracis ячейки чипа содержат иммобилизованные праймеры с генами lef и pag. (В.Е.Барский, А.М.Колчинский, Ю.П.Лысов, А.Д.Мирзабеков. Биологические микрочипы, содержащие иммобилизованные в гидрогеле нуклеиновые кислоты, белки и другие соединения: свойства и приложение в геномике. Мол.биол.,2002,т.36,№4,с.563-584).

В США также разработан метод микрочиповой твердофазной экстракции для очистки ДНК из биологических образцов, таких как кровь. Кремниевые бусы упаковывают в стеклянные микрочипы и иммобилизуют бусы золь-гелем для стабилизации твердой фазы, на которой будет адсорбироваться ДНК. Оптимальное извлечение ДНК происходит при рН 6,1 – 7,6. Такие низкие значения рН позволяют сократить время экстракции с 25 мин до 15 мин. При этом единственная стадия приготовления ДНК из крови для анализа на микрочипе – смешивание крови с буфером для нанесения. Процедура детекции инфекционного агента занимает менее 30 мин. (Breadmore MC, Wolfe KA, Arcibal IG, Leung WK, Dickson D, Giordano BC, Power ME, Ferrance JP, Feldman SH, Norris PM, Landers JP. Microchip-based purification of DNA from biological samples. Anal.Chem. 2003.v.75,n.8,p.1880-6).

Использование современных молекулярно-биологических методов исследования позволяет не только быстро и достоверно обнаруживать B.anthracis в различных биологических материалах и почве, но и типировать штаммы с целью установления общего источника инфекции (Patra G., Vaissaire J., Weber-Levy M., le Doujet C., Mock M. Molecular Characterization of Bacillus Strains Involved in Outbreak of Anthrax in France in 1997. J.Clin.Microbiol.,1998,v.36,p.3412-4).

Геном B.anthracis экстремально мономорфный, что часто создает трудности в дифференциации штаммов на молекулярном уровне. Для дифференцировки использовали ПЦР на область длинных полиморфных повторов (LR REP-PCR). С одного праймера амплифицировались различные сегменты бактериального генома длиной до 10 кб. Охарактеризовали 5 генетически различных групп из разных географических регионов. Все штаммы на фингерпринтах давали 7 или 8 «скелетных» полос и от 1 до 3  «диагностических полос», различных у разных штаммов. LR REP-PCR фингерпринты  B.anthracis имеют очень мало общего с фингерпринтами других близкородственных видов, что говорит о большой гетерогенности среди не B.anthracis штамммов.  (M.J.Brumlik, U.Szymajada, D.Zakowska et al. Use of long-range repetitive element polymorphism-PCR to differentiate Bac.anthracis strains. Appl.Environmental Microbiol.,2001,v.67,n.7,p.3021-3028).

Наибольшее распространение в Европе имеют штаммы с генотипами VNTR3 и VNTR4. Исследование штаммов B.anthracis, циркулирующих в Южной Африке, также выявило неоднородность популяции возбудителя в этом регионе (Smith K.L., DeVos V., Bryden H., Price L.B., Hugh-Jones M.E., Keim P. Bacillus anthracis Diversity in Kruger National Park. J.Clin.Microbiol.,2000,v.38,p.3780-4).

Современными методами типирования (VNTR- и AFLP-анализа) 426 штаммов В. anthracis, выделенных из различных географических регионов, выявлено 89 различных генотипов, объединенных в 6 генетических групп, которые распределяются внутри двух больших филогенетических групп (А и В). Группа А представлена штаммами различного географического происхождения, в то время как изоляты группы В были выделены исключительно в Южной Африке.(P.Keim, L.B. Price, A.M.Klevytska et al. J.Bacteriol.,2000,v.182,p.2928-2936).

Свыше 500 изолятов Bacillus anthracis во всем мире представляют один из наиболее генетически гомогенных микробов. Существуют три вероятных  фактора, вызывающих эту генетическую устойчивость: (1) сибирская язва обладает необычайно точной системой восстановления; (2) генетическое повреждение обычно гибельно для сибирской язвы и/или (3) в ее окружении происходит важный и специфический процесс, необходимый для завершения ее жизненного цикла. При использовании зондов, приготовленных из генов, отобранных путем выращивания библиотеки Bacillus anthracis с вектором экспрессии Escerichia coli на гипертрофической среде с высоким содержанием нитратов, выделены гены, уникальные для B. anthracis. Повышенное нитрование приводило к образованию устойчивых хромосомных мутантов, которые демонстрировали измененную морфологию и продолжение (прогрессию) жизненного цикла. Следовательно, продолжение жизненного цикла, связанное с нитрованием, ассоциирующимся с воспалительной реакцией у хозяина, приводит к выбору мутантов, демонстрирующих продолжение жизненного цикла, связанное с прогрессией воспалительной реакции на сибирскую язву. Значительное отклонение от этой связанной прогрессии приводит к неспособности сибирской язвы продолжить свой жизненный цикл после смерти своего хозяина. (J.L.Kiel, J.E.Parker, H.Gifforo et al. Basis for the extraordinary genetic stability of Anthrax. Ann.N.Y.Acad.Sci.2002,v.969,p.112-118).

В случае биотерроризма необходим инструмент для быстрой дифференциации Bacillus anthracis от других близкородственных спорообразующих видов Bacillus. Во время недавней вспышки сибирской язвы,  связанной биотерроризмом, были секвенированы гены 16S рРНК из этих видов, чтобы оценить возможности секвенирования гена 16S рРНК в качестве инструмента диагностики. Обнаружено 8 различных типов 16S среди всех 107 последовательностей гена 16S рРНК, которые отличались друг от друга в 1-8 позициях (0,06% - 0,5%). Все 86 B. anthracis имели идентичную последовательность гена 16S, обозначенную как тип 6; тип 10 16S наблюдался во всех штаммах B. thuringiensis; 6 других типов 16S были обнаружены среди 10 штаммов B. Cereus. Описана демонстрация исключительной связи определенной последовательности 16S с B. anthracis. Данный подход позволил быстро идентифицировать подозрительные изоляты и выявить ген 16S рРНК B. anthracis непосредственно из отрицательных в культуре клинических образцов от 7 пациентов с клинически подтвержденной сибирской язвой.(C.T.Sacchi, A.W.Whitney, L.W.Morey et al. Sequencing of 16S rRNA gene: a rapid tool for identification of Bacillus anthracis. Emerg. Infect. Dis., 2002,v.8,n.10,p.1117-1124).

Молекулярное субтипирование Bacillus anthracis сыграло важную роль в дифференциации и идентификации штаммов во время связанной с биотерроризмом вспышки 2001 года. Так как B. anthracis имеет низкий уровень генетической изменчивости, существует всего лишь несколько методов субтипирования, различающихся своей надежностью. Первоначально использовали многолокусный анализ с различным числом тандемных повторов (MLVA) для субтипирования 135 изолятов B. anthracis, связанных со вспышкой. Все изоляты были определены как принадлежащие к генотипу 62, как и штамм Ames, используемый в лабораториях. Cеквенировали ген защитного антигена (pagA) из 42 представительных изолятов, полученных во время вспышки, и определили, что они имели последовательность pagA, неотличимую от штамма Ames (PA генотип 1). MLVA и секвенирование pagA применялись также на ДНК из клинических образцов, делая субтипирование B. anthracis возможным без изолята. Использование молекулярного субтипирования высокого разрешения выявило, что все изоляты, полученные во время вспышки, были неразличимы используемыми методами и, возможно, происходили из одного источника. Кроме того, субтипирование позволяло быстро идентифицировать лабораторные контаминанты и изоляты, не связанные со вспышкой.(A.R.Hoffmaster, C.C.Fitzgerald, E.Ribot et al. Molecular subtyping of Bacillus anthracis and the 2001 bioterrorism-associated anthraxoutbreak, Unated States. Emerg. Infect. Dis., 2002,v.8,n.10,p.1111-1117).

Таким образом, представленный краткий обзор публикаций за последние годы свидетельствует об активной деятельности ученых в самых разных странах в направлении разработки и создания тест-систем для быстрой индикации и идентификации спор сибирской язвы в самых разнообразных образцах (кровь, носоглоточные смывы, образцы ткани, шерсть, воздух, твердые поверхности и т.п.) с использованием самых современных молекулярно-биологических подходов. Для проведения эффективного мониторинга сибирской язвы активно разрабатываются новые методы молекулярно-генетического типирования этого возбудителя.


 

А также другие работы, которые могут Вас заинтересовать

1190. IP-адресация 78.5 KB
  Поиск и выбор IP-адреса. Центр управления сетями и общим доступом. Беспроводное сетевое соединение. Управление сетевыми подключениями.
1191. Фармакология периферической нервной системы 51 KB
  Структурно-функциональные особенности автономной (вегетативной) и соматической иннервации. Механизм передачи нервного импульса в синапсах автономной нервной системы. Эффекты возбуждения симпатических и парасимпатических нервов. Принципы фармакологической регуляции нейромедиаторных процессов. Классификация веществ, действующих на автономную нервную систему.
1192. Исследование ассортимента и качества конфет в розничной торговой сети «Рассвет» 346.34 KB
  Характеристика магазина «Рассвет» и основных показателей хозяйственной деятельности. Производители – источники поступления конфетных изделий в магазин «Рассвет». Приемка конфетных изделий по качеству и количеству в магазине «Рассвет». Анализ ассортимента конфетных изделий в магазине по видам. Результаты исследований ассортимента конфет в магазине по показателям: широта, полнота, устойчивость, новизна...
1193. Технико-экономические показатели автоматизации комплекса очистных сооружений 139.5 KB
  расчёт прогнозируемого объёма переработки загрязнённых вод на комплексе очистных сооружений. Расчет потребности капитальных вложений в основные фонды. Расчёт заработной платы. Расчёт затрат на потребление теплоэнергии (пара). Основные технико-экономические показатели автоматизации комплекса.
1194. Привод подвесного конвейера 1.04 MB
  Определение расчетной мощности электродвигателя. Выбор двигателя по каталогу. Определение передаточных чисел мощностей, частот вращения и крутящих моментов на валах привода. Расчет открытой прямозубой цилиндрической зубчатой передачи. Определение допускаемых напряжений для шестерни и колеса, при расчете на выносливость при изгибе.
1195. Организационно-экономическая часть создания системы автоматизированного проектирования 185.5 KB
  Технико-экономическое обоснование целесообразости проекта. Использование программно-аппаратных средств. Расчёт договорной цены разработки ячейки. Дополнительная заработная плата научного персонала. Календарный график работ по разработке блока.
1196. Газотурбинные установки. Машины и оборудование. Охрана труда. Строительные конструкции. 368.5 KB
  Устройство камер сгорания и теплообменных аппаратов ГТУ. Назначение, устройство и виды фильтров, используемых в гту. назначение и устройство глушителей, применяемых в компрессорах. Запорная арматура: назначение, устройство, принцип действия, примущества, недостатки, ремонтнопригодность. Устройство и принцип действия центробежного нагнетателя. Требования к проведению инструктажей по охране труда, их виды и сроки проведения.
1197. Приспособление для проведения механических испытаний 74.5 KB
  Схема сборки приспособления для проведения вибрационных испытаний. Универсальная оснастка плита для проведения вибрационных испытаний. Эта оснастка используется для проведения испытаний множества приборов.
1198. Производственный анализ СПК Октябрьский Волотовского района 63.5 KB
  Уставный капитал колхоза составляет 29531 тыс. руб. Учредителями хозяйства являются члены кооператива, которые объединили свои имущественные и земельные доли. Основным видом деятельности является сельское хозяйство, доля выручки от продажи сельскохозяйственной продукции на 2010 год составила 98 %.