38559

Модифікація гена kanMX4, що забезпечує резистентність до антибіотика генетицину

Дипломная

Биология и генетика

Це у значній мірі відбувається тому що клітинний цикл та фізіологічні процеси клітин дріжджів дуже подібні до відповідних процесів людських клітин і тому основні клітинні механізми реплікація ДНК рекомбінація поділ клітини і метаболізм мають багато спільних рис. пар основ плазмідної ДНК яку в деяких штамах складають кіллерні плазміди; мітохондріальний геном 75 тис. Отримані гелі можуть бути використані для проведення Саузернблот аналізу що супроводжується гібридизацією або для ізоляції хромосомної ДНК в чистому вигляді. Досить...

Русский

2013-09-28

1.36 MB

4 чел.

I. ОГЛЯД ЛІТЕРАТУРИ

1. Дріжджі Saccharomyces cerevisiae – універсальний модельний організм.

1.1. Дріжджі Saccharomyces cerevisiae як експериментальна система молекулярної біології

Дріжджі мають довгу історію використання у різноманітних дослідженнях у генетиці, молекулярній біології та біотехнології. Кілька видів дріжджів, особливо  Saccharomyces cerevisiae, широко використовуються у генетиці і клітинній біології як модельний організм. Це у значній мірі відбувається тому, що клітинний цикл та фізіологічні процеси клітин дріжджів дуже подібні до відповідних процесів людських клітин, і тому основні клітинні механізми,  реплікація ДНК рекомбінація, поділ клітини і метаболізм мають багато спільних рис. Також багато білків, важливих у біології людини, вперше були знайдені при вивченні їхніх гомологів у дріжджах; ці білки включають білки клітинного циклу, сигнальні білки і ферменти, що модифікують білки. [Mortimer et al., 1992].

Протягом довгого часу було розроблено велику кількість методів для вивчення різних клітинних та метаболічних шляхів у цього виду. Також, S. сerevisiae є основним вибором біотехнологічної індустрії, яка швидко розвивається, оскільки вимагає нових організмів-хазяїнів для продукції ряду білків, так як бактерійні системи не завжди здатні до цього. [FEMS]

Пекарські дріжджі були представлені як модельний організм у 30-х роках XX століття [Roman, 1981] і з того часу їм приділяється все більше уваги. Витонченість генетики дріжджів і легкість маніпуляції з геномом і на кінець технічний прорив у трансформації дріжджів, що використовується у реверсивній генетиці, зробило суттєвий внесок у стрімкий прогрес у молекулярній біології дріжджів. [Earlier compilations: Strathern et al., 1981; Broach et al., 1991; Guthrie & Fink, 1991]. This success is also due to the fact, which was not anticipated then a couple of years ago, that the extent to which basic biological structures and processes have been conserved throughout eukaryotic life is remarkable. 

Біотехнологія дріжджів Saccharomyces cerevisiae складається з таких елементів [Broach, J.R. Pringle, J.R. and Jones, E.W. The Molecular and Cellular Biology of the Yeast Saccharomyces. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1991.]:

  1.  Харчова промисловість, хімічна технологія: хлібопечення, вироблення ферментів,харчових добавок і.т.д;
  2.  Біологічні дослідження: клітинна біологія, генетика, біохімія;
  3.  Промислова ферментація: пивоваріння, виробництво етанолу, інших продуктів ферментації;
  4.  Біомедичні дослідження: рак, ВІЛ, виробництво ліків,генотоксичний скринінг, генетичні розлади;
  5.  Екологічні дослідження: утилізація відходів, хімічний захист рослин, біосорбція металів;

Пекарські дріжджі (S.cerevisiae) використовуються в пивній промисловості, для  виготовлення алкогольних напоїв із соків ягід і фруктів, а також зі злакових культур ще з прадавніх часів. Хлібопекарські дріжджі протягом усього, або більшої частини життєвого циклу здатні перебувати у вигляді окремих клітин. Ці дріжджі є хорошою моделлю для вивчення багатьох метаболічних процесів і явищ. У дріжджовій клітині наявні структури, які притаманні еукаріотичним клітинам, а саме: ендоплазматичний ретикулум, ядро, мітохондрії, апарат Гольджі, вакуолі та гранули запасних речовин.

Цей вид дріжджів слугує прикладом успішного застосування різних прийомів метаболічної інженерії. S.cerevisiae здатні продукувати етанол з 6-С цукрів, але не можуть ферметувати 5-С цукри, тому до сьогодні ведеться робота над удосконаленням процесу алкогольної ферментації в S.cerevisiae. При цьому застосовуються різні методи генної та метаболічної інженерії для конструювання штамів, здатних до активної ферментації пентоз.

Починаючи з 1960 року S. сerevisiae були представлені як експериментальна система для молекулярної біології. Ще в 1980 році дріжджі використовувалися для продукції вакцини від гепатиту В. У 1996 році дріжджі стали першими еукаріотичними організмами, для яких був повністю секвенований їхній геном. Зручність генетичних маніпуляцій з даними організмами відкрило можливість функціонально аналізувати продукти генів інших еукаріот у дріжджових клітинах.

Добре відомо, що дріжджові клітини є ідеальною системою, в якій можуть бути досліджені  фундаментальні клітинні механізми. Серед інших еукаріотичних моделей, S. сerevisiae мають декілька переваг:

  •  S. сerevisiae – одноклітинні організми, який, на відміну від більш складних еукаріотів, може рости у визначених умовах, що дає досліднику повний контроль над регулюванням параметрів культурального середовища;
  •  Дріжджі зручні для проведення класичних генетичних методик, які були детально розроблені з застосуванням біохімічних методів [Earlier compilations: Strathern et al.,1981; Broach et al., 1991; Guthrie & Fink, 1991]. Фактично, велика кількість прикладів вказують на те, що основні клітинні функції є висококонсервативними від дріжджів до ссавців і відповідні гени часто комплементуються.
  •  Дріжджі – перші еукаріотичні організми, геном яких був повністю секвенований [Goffeau et al.,1996; Dujon, 1996].

         1.2 Експериментальні підходи у молекулярній біології дріжджів

24 квітня 1996 року була зроблена заява, що S. cerevisiae став першим еукаріотичним організмом, чий геном, що складається з 12 млн. пар основ, був повністю секвенований у рамках геномного проекту. [Williams N Genome Projects: Yeast Genome Sequence Ferments New Research // Science. — Т. 272. — (April 26, 1996) (5261) С. 481–0]. У той час це був найскладніший організм, чий геном був секвенований, цей процес зайняв 7 років і залучав більш ніж 100 лабораторій. Наступним видом дріжджів, чий геном був секвенований, був  Schizosaccharomyces pombe, завершений у 2002 році.  Це був шостий геном еукаріотів розміром 13,2 млн. пар основ. На даний час повна послідовність геному S. cerevisiae  складається з таких елементів:

  •  6000 відкриті рамки зчитування, більшість з яких кодують специфічні білки. Встановлено, що на кожну другу  тисячу нуклеотидів в геномі припадає  білок-кодуючі гени [Dujon, 1996].
  •  біля 120 генів рибосомальної РНК у великому тандемному масиві на XII хромосомі;
  •  40 генів, що кодують малі ядерні РНК (мяРНК);
  •  274 гени тРНК, розкидані по всьому геному;
  •  біля 50 копій дріжджових транспозонів (Ту-елементів);
  •  послідовності позахромосомних елементів: 6 тис. пар основ плазмідної ДНК, яку в деяких штамах складають кіллерні плазміди;  
  •  мітохондріальний геном (75 тис. пар основ)

Геном S. cerevisiae складається з 16-ти хромосом, розмір  яких коливається в межах від 250-ти до 2500 тис. пар основ [Carle & Olson, 1985]. Таким чином, підбираючі відповідні умови, можна розділити всі 16 хромосом за допомогою гель-електрофорезу у пульсуючому полі. Це дає визначення поняттю „електрофоретичні каріотипи” штамів шляхом розділення їх хромосом ща розміром [Carle & Olson, 1985]. Отримані гелі можуть бути використані для проведення Саузерн-блот аналізу, що супроводжується гібридизацією, або для ізоляції хромосомної ДНК в чистому вигляді.  Перша генетична карта  S. cerevisiae була опублікована Ліндегреном у 1949 році [Lindegren, 19949] і з того часу зазнала багатьох переглядів та уточнень. Для картування генів дріжджів були розроблені як мейотичні, так і мітотичні підходи. Життєвий цикл S. cerevisiae поділяється на гапло- і диплофазу. Обидва плоїди можуть існувати у стабільних умовах.

Гаплоїдні аскоміцетні дріжджові клітини мають два типи спаровування: а і α. Термін «стать» не використовується, оскільки клітини морфологічно ідентичні і розрізняються тільки одним генетичним локусом MAT (від англ. mating — спаровування).

Рис 1. Життєвий цикл аскоміцетних гапло-діплоїдних дріжджів.

Клітини різних типів можуть зливатися і утворювати диплоїд a/α, який після мейозу дає 4 гаплоїдних аскоспори: дві а і дві α. Вегетативне розмноження аскоміцетних дріжджів можливе у різних видів або тільки на гаплоїдній стадії, або тільки на диплоїдній, або на обох (гапло-диплоїдні дріжджі). [Balasubramanian M., Bi E., Glotzer M. Comparative analysis of cytokinesis in budding yeast, fission yeast and animal cells // Curr Biol.. — Т. 14. — (2004) (18) С. R806-R818. PMID 15380095.]

За умов короткого часу клітинної генерації за дві доби можна виростити колонії, містять мільйони клітин. До того ж дріжджі можна підтримувати в гаплоїдній і диплоїдній формах, що різко спрощує їх генетичний аналіз. Як і бактерії, гаплоїдні клітини дріжджів можна використовувати для отримання ауксотрофних мутантів зі специфічними вимогами до складу поживного середовища. Рецесивні летальні мутації можна підтримувати в культурі гаплоїдних клітин у вигляді умовних летальних алелей (наприклад, термочутливих мутантів) або в культурі гетерозиготних диплоїдних клітин (що містять і аллель дикого типу і мутацію).

На даний час є доступною велика кількість протоколів для проведення генетичних маніпуляцій з клітинами дріжджів [Guthrie & Fink,1991;Johnston, 1994]. Встановлено, що час генерації дріжджів складає 90 хвилин і при цьому відбувається інтенсивне і швидке накопичення біомаси. Досить простими є процедури по виділенню з клітин таких високомолекулярних сполук, як ДНК, рДНК, мРНК і тРНК. Також є можливим ізоляція інтактного ядра або інших клітинних органел, таких як мітохондрії. За останні роки булла досягнена висока ефективність генетичної трансформації дріжджових клітин, наприклад застосування LiAc методики [Ito et al., 1983] або методом електропорації. Також було сконструйовано велику кількість векторів для введення і підтримання рекомбінантної ДНК в клітинах дріжджів [e.g. Guthrie &Fink,1991; Johnston, 1994].

Крім того, на даний час сконструйовані штами дріжджів, які несуть ауксотрофні маркери, гении стійкості до антибіотиків, а також ті, що містять в собі різноманітні індуковані мутації. Відбувається активне підтримання і накопичення колекцій культур дріжджів, наприклад у Фонді Генетики Дріжджів (англ. Yeast Genetic Stock Center - YGSC) або в Американській колекції типових культур  (англ. American Type Culture Collection - ATCC). Штами мутантів з визначеними генними делеціями разом з клонами, що несуть відповідні генні касети походять з проектів EUROFAN та TRANSATLANTIC. Протягом останніх років, у рамках виконання проекту по секвенуванню геному дріжджів, були створені впорядковані космідні бібліотеки [e.g. Thierry et al., 1993; Riles et al., 1993; Stucka & Feldmann, 1994].

Прості генетичні порушення та однокрокові генні перебудови є унікальними у S.cerevisiae і відкривають широкі можливості для дослідження. При з’єднанні з геном зеленого флюорисцентного білка (англ. green fluorescent protein – GFP - репортер експресії генів та внутріклітинної локалізації білків) гени дріжджів функціонально експресуються і локалізацію їх продуктів можна визначити методом флюорисцентної мікроскопії [Niedenthal et al., 1996].


Рис 2. Фотографія з флюорисцентного мікроскопа: септи у S.cerevisiae . зеленим кольором  септи, що містять GFP - зелений флюорисцентний білок

Дріжджам також відведена неоцінима роль у клонуванні і підтриманні величезних сегментів ДНК у геномі у штучних дріжджових хромосомах (англ. yeast artificial chromosomes – YACs), використання яких є надзвичайно активним у різноманітних проектах по секвенуванню а також вивченню білок-білкових взаємодій за допомогою двогібридного підходу [Fields & Song, 1989].

Наявність високоефективної системи гомологічної рекомбінації у дріжджів дозволяє довільно змінювати будь-яку обрану хромосомну послідовність ДНК. До того ж, можна здійснювати маніпуляції з ділянками хромосом у складі рекомбінантних плазмід, які стабільно підтримуються в діляться клітинах дріжджів, завдяки включенню до них коротких послідовностей центромери і точки початку реплікації ДНК. У дріжджах стабільно підтримуються навіть лінійні плазміди (мініхромосоми), що містять теломерні повтори по кінцях.

2. Ty-елементи дріжджів S. cerevisiae  

2.1 Структура Ту-елементів

[Lee F.W.F. et al. // Appl Microbiol Biotechnol – 1997 – vol.48 – P. 339-345.]

Ту-елементи  S. cerevisiae (transposons of yeast”)сімейство мобільних генентичних елементів геному, які присутні у 35-ти копіях в гаплоїдному геномі дріжджів; на кінцях мають довгі термінальні повтори по 340 пар основ (англ. long terminal repeats - LTR), також відомі як δ-послідовності.

Рис 2. Структура Ту1-елемента дріжджів [Modern Genetic Analysis.

Griffiths AJF, Gelbart WM, Miller JH, et al.New York: 1999.]

δ-послідовності – це довгі кінцеві повтори нуклеотидів, що входять до складу ретротранспозонів Ty1 i Ty2, що вбудовуються в геномну ДНК дріжджів. Копії цих нуклеотидних послідовностей залишаються у вихідній ділянці молекули ДНК після того, як відбулася транспозиція Ty-елемента в іншу ділянку, тому в геномі дріжджів присутня також велика кількість ізольованих δ-послідовностей. Загалом налічується близько 425 таких послідовностей у геномній ДНК S. cerevisiae

        На даний час відомо 5 основних типів Ту-елементів: Ty1 (3), Ty2 (22), Ty3 (10), Ty4 (11) і Ty5 (3), які розрізняються за довжиною, розміщенням сайтів рестриктаз, кількістю копій у гаплоїдному геномі, а також за сайтами інсерції. Ту-елементи   містять гени  складаються з двох генів: TYA1 та TYB1, що відповідають генам gag і pol ретровірусів [Curcio M.J., Garfinkel D.J. (1990) Genetics,88, 136 – 140.]..  

Рис 3. Ту-елементи дріжджів [TY ELEMENTS OF THE YEAST SACCHAROMYCES CEREVISIAE O. Krastanova1, M. Hadzhitodorov2, M. Pesheva1 Sofia University "St. Kl. Ohridski", Faculty of Biology, Microbial Genetics Laboratory,Sofia, Bulgaria1]

Рис 4. Класифікація Ту-елементів S. cerevisiae.

За своєю структурою Ту-елементи подібні до довгих термінальних повторів еукаріотичних  ретровірусів, оскільки вони позбавлені деяких функцій даних повторів і розглядаються як примітивні ретровіруси [The EMBO Journal Vol.2 No.4 pp.583-591, 1983 Delta sequences in the 5' non-coding region of yeast tRNA genesJurg Gafner, Eddy M.De Robertis1 and Peter Philippsen]. Саме через ці подібності  з ретровірусами Ту-елементи також мають назву ретротранспозони.

δ-послідовності дріжджів, так як і Ту-елементи загалом, показують дивергенцію у послідовностях. Термінальні δ-послідовності є прямим повторами, на відміну від мобільних елементів бактерій, які містять інвертовані повтори (англ. inverted repeatsIR). Однак, як і прокарітоичні як і прокарітотичні транспозони, Ту-елементи генерують повторювану послідовність ДНК-мішені (5 тис.пар основ), а також спричиняють  мутації, випадково вбудовуючись у сайти геному. Однією з основних ознак ретротранспозонів дріжджів є їх випадкова мультикопійна інтеграція у різні сайти геному клітини-хазяїна

2.2 Транспозиція Ту-елементів

Ту-мРНК транскрибується і піддається процесингу у ядрі і згодом транспортується у цитоплазму, де слугує матрицею для трансляції Gag та Gag-Pol білків [Garfinkel D.J. (1992) “RetroviralRetroelementsin Microorganisms”, Plenum press, N.Y., 107– 136.]. Ту-елементи S. cerevisiae продукують вірусоподібні частинки (англ. virus-like particles, VLPs), в яких під час процесу збірки відбувається пакування РНК, з якої шляхом зворотної транскрипції відбувається синтез повнорозмірної кДНК. На фінальному етапі транспозиції кДНК інтегрується у новий сайт геному і цикл може відбуватися повторно [Lodish,Berk,Zipursky, Baltimore, DarnellMolecular cell biology’. W.H Freeman and company, Section 9.3 Mobile DNA]

Рис 5. Транспозиція і зворотня транскрипція Ту-елемента.

 

Рис 6. Життєвий цикл ретротранспозона Saccharomyces cerevisiae:

1 – Транскрипція з Ту-елемента з утворенням  TyA/B мРНК;

2 – Пакування TyA/B мРНК у вірусоподібні частинки;

3 – Дозрівання вірусоподібних частинок

4 – Зворотня транскрипція з мРНК з утворенням кДНК;

5 – Інтеграція кДНК у геном шляхом гомологічної рекомбінації.

3. Альтернативні системи мультикопійної інтеграції векторів  у Saccharomyces cerevisiae

3.1 Альтернативна система мультикопійної інтеграції у Saccharomyces cerevisiae з використанням субтеломерних Y’-елементів

Як було зазначено вище, дріжджі Saccharomyces cerevisiae найбільш широко використовуються у молекулярній біології і біотехнології. S. cerevisiae є основним вибором біотехнологічної індустрії, яка швидко поширюється, оскільки вона вимагає нових модельних організмів для продукції великої кількості речовин (білків, амінокислот, органічних кислот, полісахаридів, багатоатомних спиртів, вітамінів і вітамінних добавок, і.т.д) і бактерійні системи не завжди спроможні до виконання функцій активних продуцентів речовин. Будучи еукаріотичним організмом, S. cerevisiae здатний продукувати комплекс білків клітин ссавців, але таке застосування дріжджів вимагає розробки для них нових методів для надпродукції даних речовин. За досить короткий проміжок часу було розроблено велику кількість методів для введення чужорідних генів у клітини дріжджів у складі векторів, що забезпечують мультикопійну трансформацію вставки. Ці методи включали способи введення  одно- і мультикопійних плазмід у геном. Такі плазміди утворюють більше, ніж 100 копій на клітину, і, як наслідок, їхня ефективна ампліфікація обмежується декількома факторами. По-перше, векторні плазміди є нестабільними у неселективних умовах. По-друге, чим більше генів вводиться в один вектор, тим більш нестабільним він стає і проведення ефективної трансформації дріжджів стає важким завданням. Для вирішення цих проблем були розроблені інтегративні підходи для здійснення ефективної мультикопійної інтеграції векторів у геном.  

Перший з них базується на інтеграції потрібних генів у локус рДНК. рДНК-локус – послідовність нуклеотидів  у геномній ДНК дріжджів довжиною 1-2 млн пар основ, що містить 200 тандемних повторів довжиною 9,1 тис. пар основ. Ці тандемні повтори розглядаються як зручний варіант для мультикопійної інтеграції. Однак детальний аналіз ДНК, інтегрованої у рДНК виявив, що, незважаючи на велику кількість можливих мішеней інтеграції, чужорідна ДНК вбудовується у дуже малу кількість сайтів і тільки після цього реплікується в умовах селективного тиску, який створюється спеціально підібраними селективними маркерами.

Другий з підходів, розроблений співробітниками Інституту біотехнології Вільнюского університету у 2011 році, базується на інтеграції субтеломерних Y’ділянок.

Y’-елементи – специфічні послідовності у геномі S. cerevisiae, що мають від 0 до 4-х копій. Встановлено, що 2/3 субтеломерних ділянок містять такі елементи. Крім того, Y’-елементи не кодують ніяких життєво важливих генів, що робить їх перспективним кандидатом для введення чужорідних генів у геном. Y’-елементи також є стійкими до сайленсингу теломер, що сприяє їх ефективній експресії.

Для того, щоб створити зручну систему для генної інтеграції у субтеломерні регіони було зконструйовано вектор під назвою pTELY. У вихідну векторну плазміду pUC57 був клонований Y’-елемент розміром 2 тис. пар основ по EcoRI сайту. Крім того, ця вставка була фланкована 4-ма 8-нуклеотидними сайтами рестрикції (MssI, MreI, NotI, SfaAI) для забезпечення ефективної лінеаризації конструкції. Всередину цієї ділянки був поміщений полілінкер, що містив 12 сайтів дії ендонуклеаз рестрикції. На кінцевому етапі ген URA3(забезпечує ауксотрофність по урацилу) був вбудований у кінець полілінкера в якості селективного маркера. Ген URA3 був фланкований His-G - прямими повторами бактерій. В проведених операцій було отримано вектор pTELY-HisG-URA3 (Рис 7):

Рис 7. Плазмідний вектор pTELY-HisG-URA3.

 

Для перевірки можливості мультикопійної інтеграції URA3 у складі плазміди в у субтеломерний локус було визначено кількість копій вектора і перевірено стабільність у неселективних умовах. Крім того, було порівняно 3 наявних шляхи трансформації дріжджів: одно- і мультикопійною плазмідою, а також інтеграцією у рДНК-локус. В роботі використовувалия такі конструкції:

    -    pRS316 – однокопійна плазміда; (Sikorski & Hieter, 1989),

    -   pRS426 – мультикопійна плазміда; (Christianson et. al.,1992)

  •  IGS1-послідовність, яка вбудовувалася  у рДНК-локус; (James, et al., 2009)

  •  досліджувана плазміда pTELY.

Вектор pTELY був лінеаризований рестриктазою Not1 і трансформований у штам, в якого був делетований ген ura3. Специфічність інтеграції була підтверджена за допомогою полімеразно-ланцюгової реакції (ПЛР). Аналогічна процедура була проведена для генерації великої кількості клонів з геном URA3,який був вбудований у рДНК-локус. Вектор,що містив ген URA3, фланкований IGS1-послідовностями був лінеаризований та траснформований у штам-делетант по ura3-гену. Після проведення кожної з трансформацій (pRS316, pRS426, рДНК, pTELY) було відібрано по 7 клонів і вирощено на чашках з YPD зі зміною 75-ти генерацій. Після росту трансформантів у неселективних умовах з них була виділена тотальна ДНК і визначена точка перетину значень рівня експресії URA3-гену методом ПЛР у реальному часі. Для визначення кількості URA3  

 

2. МАТЕРІАЛИ І МЕТОДИ ДОСЛІДЖЕНЬ

2.1. Матеріали досліджень

У роботі були використані хімічні сполуки, реактиви та ферменти виробництва фірм: «Sigma» (США), «Fluka» (Німеччина), «Fermentas» (Литва), «NEB» (США), «Promega» (США). Кваліфікація хімічних реактивів вітчизняного виробництва - “хч” та “осч”.

2.2. Організми

Для рутинних генно-інженерних маніпуляцій використовували штам E. сoli DH5α (lacZΔM15, recA1, endA1, gyrA96, thi-1, hsdR17(rK-, mK+), supE44, relA1, deoR, Δ(lacZYA-argF)U169). Для отримання трансформантів дріжджів використовували лабораторний штам S. сerevisiae BY4742 (MATα, his3Δ1, leu2Δ0, lys2Δ0, ura3Δ0; Giaever et al., 2002), а також промисловий штам S. сerevisiae AS400.

2.3. Поживні середовища та умови культивування

Клітини дріжджів та бактерій вирощували у пробірках об’ємом 20 мл, що містили 3 мл середовища, колбах на 300 мл  та 50 мл, що містили 100 мл та 20 мл середовища відповідно, на круговій качалці, та на чашках Петрі з 25 мл агаризованого середовища в термостаті при 370С для бактерій та 300С для дріжджів. Для виділення плазмідної ДНК з клітин E. coli штами вирощували на середовищі  LB при  37°C протягом 18 годин (Sambrook and Rusell 2001).

В експериментах були використані середовища такого складу:

YNB min, г/л: (YNB (Yeast Nitrogen Base w/o amino acids and amonium sulfate) – 1,7; (NH4)2SO4 –  5; Глюкоза – 20

При вирощуванні штамів, ауксотрофних по лейцину, гістидину, лізину, урацилу в середовище додавали згадані фактори росту у концентрації 40 мг/л.

YPD, г/л: (Дріжджовий екстракт (YЕ) – 10; Пептон – 10; Глюкоза – 20).

LB (Лурія-Бертані), г/л: (Пептон – 15; NaCl – 10; YE – 5).

рН 7,0 доводили 2н NaОН з розрахунку 100 мкл/100 мл для рідкого і агаризованого середовища.

Агаризовані середовища містили агар (2%).

Селекцію рекомбінантних штамів проводили на середовищах з додаванням ампіциліну (100 мг/л) та генетицину (200 мг/л). 

2.4. Визначення біомаси клітин

Біомасу клітин S. cerevisiae (в мг абсолютної маси на 1 мл суспензії) визначали за мутністю розведених суспензій за допомогою спектрофотометра (СФ)  Helios Gamma UV-Visible Spectrophotometer (Thermo Spectronic) при λ = 600 нм в кюветі 1 см. 

Розрахунок проводили за формулою:

        Е600n

С = ,

          3,3

де Е600 – OD  при 600 нм;

n – розведення вихідної суспензії;

3,3 – коефіцієнт перерахунку, визначений при калібруванні гравіметричним методом.

2.5. Методи досліджень

2.5.1. Рестрикційний аналіз ДНК

Метод базується на здатності ендонуклеаз рестрикції ІІ класу гідролізувати ДНК в певних сайтах (послідовностях нуклеотидів). В роботі використовували ферменти та відповідні інкубаційні буфери виробництва фірми “Fermentas” (Литва).

У реакційну суміш вносили 0,5-2 мкг аналізованої ДНК в ТЕ-буфері чи бідистильованій воді. До розчину ДНК додавали 1/10 об’єму відповідного буферу і 1 од.акт. ферменту на 1мкг плазмідної ДНК, реакційну суміш доводили водою до відповідного об’эму. Суміш інкубували при 37оС 1-2 години.

2.5.2. Дефосфорилювання

До розчину ДНК 10-40 мкл (1-20 пкмоль кінців) додавали 5 мкл 10х-буферу для реакції дефосфорилювання, 1 мкл лужної фосфатази і об'єм доводили до 50 мкл водою. Суміш інкубували протягом 30 хв при 37°С. Після цього ДНК очищували за допомогою фенолу або наносили на колонки.

2.5.3. Елюція фрагментів ДНК з агарозного гелю

  1.  Вирізали відповідний фрагмент ДНК з агарозного гелю, додавали 2 об'єми буферу, що зв’язує ДНК. Фрагмент гелю розплавляли при 50-55°С 5-10 хв. Наносили даний розчин на колонку, центрифугували 1 хв. при 12000 об/хв.
  2.  Додавали буфером для відмивання (500 мкл), центрифугували 1 хв. при 12000 об/хв. Додавали 10-50 мкл Н2О, ТЕ-буферу або буферу для елюції та центрифугували 1 хв. при 12000 об/хв.

2.5.4. Лігування ДНК-вставки з ДНК-вектором

Готували 10 мкл суміші фрагменту і розщепленого вектора (400-800 нг) у бідистильованій воді; реакційна суміш містила рівну чи вищу (до 3 разів) концентрацію кінців фрагменту по відношенню до концентрації кінців вектора;

Додавали наступні компоненти до суміші:

                10×буфер для лігування     -        2 мкл

                Т4 ДНК лігаза                     -        2-4 од.акт.

                бідист. . Н2О                        -        до 20 мкл

3. Інкубували суміш при кімнатній температурі протягом 30 хв та трансформували нею клітини E. coli DH5α.

2.5.5. Електрофорез ДНК в агарозному гелі

Реактиви: агароза; TAE буфер (0,04 М тріс-ацетат; 0,002 М ЕДТА); буфер для нанесення проб (0,1% бромфеноловий синій; 0,5% ДСН; 0,1М ЕДТА(pH 8.0); 50 % гліцерол).

Агарозу вносять в TAE буфер, нагрівають до повного розчинення і кип'ятять протягом 3 хв. Коли розчин охолоджується до 50оC, додають бромистий етидій. Охолоджений розчин заливають у кювету з гребінцем для формування лунок. Необхідно, щоб між дном кювети і гребінцем залишався шар агарози товщиною 0,5-1 мм. Після полімеризації гелю гребінець видаляють, а кювету з гелем поміщають в електрофоретичну камеру з ТАЕ буфером. В лунки вносять виділену ДНК (0,2-0,5 мкг), змішану з буфером для нанесення проб так, щоб об'єм буферу становив 1/6 об'єму кінцевої суміші. Електрофорез проводять при напрузі 2-4 В/см2 протягом 30-40 хв. Зони ДНК реєструють, освітлюючи гель ультрафіолетовими променями. Одержану електрофореграму фотографують.

2.5.6. Виділення плазмідної ДНК з клітин E.coli

Реактиви:розчин І: 50 мМ глюкоза, 25 мМ Tris-HCl (pH 8.0), 10 мМ ЕДТА (pH8.0); розчин ІІ: 0,2 М NaOH, 1% SDS; 5М Калій ацетат; 3М Натрій ацетат; 7,5М Амоній ацетат; фенол (pH 8.0); ізопропанол; 96% спирт; 70% спирт.

Бактерійні трансформанти нарощують в 100 мл селективного середовища протягом ночі. Біомасу осаджують центрифугуванням при 4000 об/хв. протягом 15 хв. Клітини промивають розчином І і центрифугують при 4000 об/хв. 12 хв. Супернатант зливають, а осад ресуспендовують в 2 мл розчину І. Після цього до суміші додають 4 мл розчину ІІ, перемішують поки суспензія не стане в’язкою. Потім додають 3 мл 5М ацетату калію, перемішують і центрифугують при 5000 об/хв. 15 хв, супернатант переносять в чисту пробірку і додають 0,6 об’єму ізопропанолу. ДНК осаджують центрифугуванням при 4000 об/хв. 15 хв. Осад розчиняють в 200 мкл води. Для остаточної депротеїнізації до розчину додають 200 мкл фенолу,  центрифугують при 12000 об/хв і відбирають верхню (водну) фазу. Додають 1/10 об’єму ацетату натрію, 2,5 об’єми етанолу. Потім центрифугують 10 хв при 12000 об/хв. Осад (плазмідна ДНК) промивають 70% етанолом, підсушують і розчиняють в воді або ТЕ-буфері.

2.5.7. Електротрансформація клітин Е. сoli

Свіжу колонію бактерійних клітин інокулюють в 2 мл рідкого середовища LB та вирощують в умовах аерації при 370С протягом ночі. 1 мл „нічної” культури переносять в 100 мл рідкого середовища LB та підрощують до ОD 600 = 0,5 – 1,0 (кювета 1 см), що відповідає 1010 кл./мл. Клітини осаджують 15 хв. при 4 000 об./хв., 40С і промивають в 400 мл стерильній холодній бідистильованій воді. Клітини ресуспендують в 200 – 300 мкл холодного стерильного 10 % гліцерину і переносять в стерильні епендорфи по 40 мкл для довготривалого зберігання при – 700С.

До 40 мкл суспензії клітин додають 1-4 нг плазмідної ДНК (зразок) і вносять суміш на дно охолодженої 2-мм кювети; здійснюють електротрансформацію (12,25 кВ/см, 50 мкФ, 129 Ом) тривалістю 5-6 мс. До кожного зразка додають по 960 мкл рідкого середовища LB, трансформовані клітини інкубують протягом 1 год при 370С. Отриману суспензію висівають на чашки з селективним середовищем та інкубують від 12 до 16 годин при 370С.

2.5.8.  Полімеразна ланцюгова реакція (ПЛР)

Для забезпечення протікання кількох паралельних реакцій готували реакційну суміш, у склад якої входили вода, буфер, дезоксинуклеотидтрифосфати (дНТФ), праймери і полімераза, в одному епендорфі, а потім розділяли на кілька окремих проб. Після розділення додавали розчин ДНК. Дані реакції проводилися на ампліфікаторі Gene Amp© PCR System 9700.

Склад реакційної суміші

реагент                                                        кінцева концентрація

стерильна деіонізована вода                                 -

10х PCR буфер                                                       1х

2 мМ суміш дНТФ                                                   0,2 мМ кожного

праймер 1                                                                 0,1-1 мкл

праймер 2                                                                 0,1-1 мкл

полімераза                                                                1,25 u/ 50мкл

матриця ДНК                                                            10 пг- 1 мкг

2.5.9. Виділення хромосомної ДНК з клітин S. сerevisiae 

Реактиви:50мМ ЕДТА (рН 8,0); літиказа (50 мг/мл); ізопропанол;  70% етанол; РНКаза А;  Фенол; 96% етанол; 5 М калій ацетат; 3 М натрій ацетат;  Nuclei Lysis Solution: 0,2% ДСН; 50мМ ЕДТА (рН 8,0).

Культуру клітин підрощували протягом ночі у поживному середовищі (3 мл) при температурі 28-30˚С. Культуру осаджували при 13000 g потягом 2 хвилин. Клітини ресуспендували в 293 мкл 50мМ ЕДТА та  додавали 7 мкл літикази (концентрація 20 мг/мл) і перемішували. Клітини інкубували при 37˚С протягом години для руйнування клітинної стінки. Після цього клітини осаджували, додавали 300 мкл Nuclei Lysis Solution та інтенсивно піпетували. Епендорфи прогрівали при температурі 65˚С протягом 15 хвилин. Потім додавали 100 мкл 5 М калій ацетату для осадження білків. Білки відділяли центрифугуванням при 13000 g потягом 3 хвилин. Супернатант додавали у епендорфи до 0,7 обєму ізопропанолу, центрифугували при 13000 g 2 хв, промивали в 500 мкл 76% етанолу, висушували, розчиняли в 100 мкл дистильованої води.

Потім додавали рівний об’єм фенолу, перемішували, центрифугували при 14000 об/хв 10 хв. Верхню (водну) фазу відбирали, до неї додавали 1/10 об’єму 3 М натрій ацетату і 2,5 об’єми 96% етанолу. Інкубували при температурі -20°С 10-15 хв. Суміш центрифугували  при 14000 об/хв 10 хв при температурі +4°С, осад ДНК промивали 76% етанолом. Розчиняли в дистильованій воді чи ТЕ буфері.

2.5.10. Довготривале зберігання бактерійних та дріжджових трансформантів

Для довготривалого зберігання бактерійні трансформанти вирощують в пробірках (3 мл) селективного середовища при 37оС протягом ночі. Клітини осаджують центрифугуванням при 4000 об/хв протягом 5-10 хв. 0,5 мл клітин вносять у мікропробірку з 0,5 мл 70 % стерильного холодного гліцерину, заморожують та зберігають при -70 оС.

Дріжджові трансформанти вирощують в пробірках (3 мл) YPМ середовища при 30оС протягом ночі. Клітини осаджують центрифугуванням при 3000 об/хв протягом 5-10 хв. 0,5 мл клітин вносять у мікропробірку з 0,5 мл 70 % стерильного холодного гліцерину, заморожують та зберігають при -70оС.

2.5.11. Трансформація дріжджів S. сerevisiae Li-Ac методом
(хімічна трансформація)

В 200 мл (100 мл) YPМ інокулюють 1 мл (0,5 мл) нічної культури дріжджів та вирощують до ОД600 = 1.

Клітини осаджують, промивають стерильною водою, та ресуспендують у 1 мл LiAc/TE буферу (0.1М  Літій ацетат , 10 mM Tris–HCl, 1 mM EDTA pH=7.5).

Інкубують протягом години при 30ºС, повторно осаджують  клітини і ресуспендують у свіжому LiAc/TE буфері  до концентрації 5×109 клітин/мл (OD600 ≈100).

Додають аліквоти клітин по 50 мкл

0,5 – 10 мкг ДНК (в ≤ 10 мкл об’ємі)  та 250 мкл 50% поліетиленгліколю у суміші із трансформаційним буфером додають до суспензії. Інкубують при 30 оС протягом 30 хв.

Клітини переносять на водяну баню, витримують 15 хв при 42ºС, після чого переносять на лід на 1 хв.

Клітини осаджують 10 хв при 3000 об/хв і ресуспендовують  в 1 мл YPМ. Інкубують 1,5-2 години та  висівають на селективне середовище.

Інкубують протягом 3-5 днів при 30 ºС.

2.5.12. Визначення стабільності дріжджових трансформантів

Окремі клони трансформантів засівають у рідке неселективне поживне середовище (YРМ) та інкубують при 37°С протягом 15 генерацій (22,5 год. для S. сerevisiae). Клітинну суспензію розводять і засівають на чашки з неселективним агаризованим YРМ. Інкубують протягом 2 діб при 30°С та роблять відбитки колоній на чашки з селективним середовищем (YPD + зеоцин, YPD + генетицин, YNB + leu, ura, trp). Після інкубації протягом 3 діб, 30°С визначають кількість клітин, що зберегли потрібний фенотип.

2.5.13. Отримання безклітинного екстракту

Дріжджові клітини осаджували центрифугуванням на 3000 g протягом 3 хв при  40С в мікропробірках типу еппендорф. Супернатант відбирали, а клітини промивали 1 мл дистильованої води та двічі буфером для промивання за тих же умов центрифугування. Клітини, що залишилися, зберігали на  -200С і використовували для приготування безклітинного екстракту.

До мікропробірок типу еппендорф із досліджуваними клітинами додавали „балотіні” (скляні кульки) рівного об’єму і такий же об’єм буферу для руйнування клітин. Руйнували на дезінтеграторі протягом 2 хв (6 разів з двохвилинним охолодженням). Гомогенат центрифугували на 14000g×20 хв при +40С. Отриманий екстракт використовували для визначення білка та активності фермента лужної фосфатази.

Буфер для руйнування клітин: 50 mM  Tris-HCl pH 7,5; 2 mM EDTA.

2.5.14. Визначення концентрації білка у безклітинних екстрактах методом Лоурі

Реактиви:

А ─ 2 % р-н Na2CO3 в 0.1 н NaOH;

Б ─ 0,5 % р-н СuSO4·5H2O в 1 % цитраті натрію;

В ─ 1 мл р-ну А змішують з 50 мл р-ну Б;

С ─ реактив Фоліна-Чокальтеу розводять водою до кінцевої концентрації 1 н.

До 100 мкл досліджуваного розчину додавали1 мл р-ну В, залишали стояти при кімнатній температурі 10 хв. До одержаної суміші швидко додавали 100 мкл р-ну С, енергійно перемішували і через 40 хв вимірювали величину екстинкції при 750 нм в кюветі 1 см.

Калібрувальну криву будували за розчином бичачого сироваткового альбуміну відомої концентрації -  10-100 мкг/мл.

2.5.15. Визначення активності лужної фосфатази

Метод грунтується на здатності лужної фосфатази розщеплювати фосфорильовані субстрати, зокрема, р-нітрофенілфосфат (pNPP), з утворенням забарвленої сполуки р-нітрофенолу.

Отриманий безклітинний екстракт розводили 50мМ Tris-HCl pH 7,5 буфером до кінцевої концентрації білка 0,025-0,05 мг/мл та розкапували по 100 мкл в мікропробірки. До кожного зразка додавали по 0,6 мл  дистильованої води, 100 мкл 0,1 М MgCl2x6H2O і 100 мкл 0,5 М Tris-HCl pH 8,9.

Реакцію запускали, додаючи 100 мкл 0,1 М pNPP та вимірювали зміну оптичної густини в кінетиці протягом 10 хв (довжина хвилі 410 нм, кювета 1 см).

Активність лужної фосфатази обчислювали за формулою:

А= ∆OD410 / (18 × P × t), де ∆OD410 – зміна оптичної густини продукту; 18 – оптична густина розчину 1 ммоль/мл р-нітрофенолу; P– концентрація білка, мг/мл; t – тривалість реакції, хв.

3. Результати

3.1 Модифікація гена kanMX4, що забезпечує резистентність до антибіотика генетицину.

Ген kanMX4 застосовується як гетерологічний домінантний селективний маркер для S. cerevisiae. Наявність щонайменше однієї копії цього гена в геномній ДНК дріжджів забезпечує їх резистентність до антибіотика генетицину (в концентрації 200 мг/л для S. cerevisiae). Було поставлено завдання модифікувати ген kanMX4 таким чином, щоб він працював менш ефективно. Тоді для селекції дріжджових трансформантів необхідна наявність багатьох копій модифікованого селективного маркера в геномі відповідних штамів. Селекцію модифікованого гена kanMX4 здійснюють в клітинах E. coli. Для цього спочатку визначають мінімальну концентрацію генетицину, що здатна інгібувати ріст культури E. coli – це 2 мг генетицину на 1 л середовища. В подальшому проводять ПЛР з використанням праймерів Ко446 та Ко447 (див. табл. 1) на матриці плазміди pRS303K, що містить у своєму складі ген kanMX4, за умов, що сприяють виникненню великої кількості помилок при копіюванні ланцюга ДНК (висока концентрація йонів Mg2+, наявність йонів Mn2+, непропорційні концентрації нуклеотидтрифосфатів у реакційній суміші, використання ДНК-полімерази з низькою точністю зчитування). Сукупність ампліфікованих фрагментів ДНК, що містять у своєму складі різноманітні нулеотидні заміни, обробляють ендонуклеазою рестрикції XbaI і клонують у відповідний сайт плазміди pUC57. Відбір трансформантів E. coli, що містять плазміду зі вставкою, проводять на середовищі з ампіциліном (100 мг/л) та генетицином (2 мг/л). Отримані колонії трансформантів за допомогою методу реплік переносять на середовище з вищою концентрацією генетицину (10 мг/л) і відбирають трансформанти, що не здатні рости при такій концентрації антибіотика. У подальшому з одного з відібраних трансформантів E. coli отримують плазміду, що містить у своєму складі модифікований ген kanMX4.

3.2. Конструювання рекомбінантних штамів S. cerevisiae з надекспресією інтактної та вкороченої форми гена PHO8.

Геномну ДНК S. cerevisiae BY4742 використовують як матрицю для ампліфікації δ-послідовностей за допомогою ПЛР: частину послідовності YJRWdelta12 (Saccharomyces Genome Database// www.yeastgenome.org/) розміром 154 пн ампліфікують з допомогою праймерів SM16/SM17 (Таблиця 1), іншу частину розміром 180 пн  ампліфікують з допомогою праймерів SM18/SM19. В подальшому обидва фрагменти об’єднують з допомогою ПЛР з використанням праймерів SM16/SM19, обробляють рестриктазами EcoRI та HindIII і клонують у плазмідний вектор pUC57. Сконструйовану плазміду позначено pUC57-delta1_2. Фрагмент ДНК розміром 807 пн, що відповідає промотору гена ADH1 (кодує алкогольдегідрогеназу), ампліфікують з геномної ДНК штаму S. cerevisiae BY4742 за допомогою праймерів Ко419 і Ко420. Фрагмент ДНК розміром 269 пн, що відповідає термінатору гена CYC1 (що кодує цитохром С), ампліфікують з геномної ДНК штаму S. cerevisiae BY4742 за допомогою праймерів Ко453 та Ко454. Потім ці два фрагменти об’єднують з допомогою ПЛР з використанням праймерів Ко419 і Ко454. Отриманий фрагмент ДНК обробляють ендонуклеазами рестрикції SalI i XmaI і клонують по відповідних сайтах у плазміду pUC57-delta1_2. Отриману плазміду позначено pUC57-delta1_2-ADHpr-CYCt. Фрагмент ДНК розміром 1701 пн, що відповідає ВРЗ гена PHO8 S. cerevisiae, ампліфікують з використанням праймерів Ko508 і Ko509 і геномної ДНК BY4742 як матриці. Після очистки цей фрагмент обробляють ендонуклеазами рестрикції BamHI i NotI і клонують в плазміду pUC57-delta1_2-ADHpr-CYCt. Отриманий вектор названо pUC57-delta1_2-ADHpr-PHO8-CYCt. Модифікований ген kanMX4 у складі SacI/SmaI-фрагмента, обробленого Т4-ДНК-полімеразою для утворення «тупих» кінців клонують у Xba-лінеаризований та оброблений Т4-ДНК-полімеразою вектор pUC57-delta1_2-ADHpr-PHO8-CYCt. Отриману плазміду позначено pUC57-delta1_2-ADHpr-PHO8-CYCt-kanMXmut (Рис. 2). Також для порівняння конструюють вектор, що містить нативний ген kanMX4, його позначено pUC57-delta1_2-ADHpr-PHO8-CYCt-kanMX.

Таблиця 1

Перелік праймерів, використаних у роботі

Назва праймера

Послідовність нуклеотидів

SM16

5’-CCGGAATTCGACGGGCAGTCTGTTGGAATAGAAATCAACTATC-3

SM17

5’- CATCATTTTATATGTTTATATTCATCTAGACCCGGGGTCGAC TTGATCCTATTACATTATCAATCC - 3’

SM18

5’- GGATTGATAATGTAATAGGATCAAGTCGACCCCGGGTCTAGA TGAATATAAACATATAAAATGATG - 3’

SM19

5’-CCCAAGCTTGACGGGCAGTCTGAGAAATATGTGAATGTTGAG-3’

SM28

5’-CGCGGATCCATGTCTGCATCACACAAGAAGAAGAATGTC-3’

SM29

5’-TTTGCGGCCGCTCAATCTGATGTGTGTTTGGTGTCCCTAATC-3’

Ko419

5’- CGCGTCGACTTAATTAAAGTCCAATGCTAG - 3’

Ko420

5’- GATATCGACAAAGGAAAAGGGGCGGCCGCGGATCCCTCGAGT GTATATGAGATAGTTGATTG - 3’

Ko446

5’- CCGGGATCCTCTAGAGTGATGACGGTGAAAACCTCTG - 3’

Ko447

5’- CCGGGATCCTCTAGACTTACGCATCTGTGCGGTATTTC - 3’

Ko453

5’- CAATCAACTATCTCATATACACTCGAGGGATCCGCGGCC GCCCCTTTTCCTTTGTCGATATC - 3’

Ko454

5’- CCCCCCGGGGCAAATTAAAGCCTTCGAGC - 3’

Ko508

5’- CGCGGATCCATGATGACTCACACATTACCAAGC - 3’

Ko509

5’- TTTGCGGCCGCTCAGTTGGTCAACTCATGGTAGTATTC - 3’

 Рис. 2. Лінійна схема плазміди pUC57-delta1_2-ADHpr-PHO8-CYCt-kanMXmut.

Вектори pUC57-delta1_2-ADHpr-PHO8-CYCt-kanMXmut та pUC57-delta1_2-ADHpr-PHO8-CYCt-kanMX обробляють ендонуклеазою рестрикції AhdI (при цьому видаляється частина вектора, що відповідає плазміді pUC57) і використовують для трансформації штаму S. cerevisiae BY4742. Селекцію генетицин-резистентних трансформантів проводять на середовищі YPD з додаванням 200 мг/л G418. Наявність в геномі трансформантів експресійної касети ADHpr-PHO8 перевіряють за допомогою ПЛР з використанням відповідної пари праймерів (Ко419 та Ко509) (див. табл. 1). Визначення копійності гена PHO8 в геномі рекомбінантних штамів здійснюється за допомогою дот-блот гібридизації (Рис. 3). Вектор pUC57-delta1_2-ADHpr-PHO8-CYCt-kanMX забезпечує високу частоту трансформації S. cerevisiae, ~ 103 трансформантів/мкг ДНК, проте включається в геном найчастіше в 1-2 копіях, а вектор pUC57-delta1_2-ADHpr-PHO8-CYCt-kanMXmut, що забезпечує значно нижчу частоту трансформації, ~ 101 трансформантів/мкг ДНК, дозволяє отримати трансформанти, що містять від 3 до 7-9 додаткових копій гена PHO8. Визначення питомої активності лужної фосфатази у рекомбінантних штамів (Рис. 4) показало, що штами, які містять вектор pUC57-delta1_2-ADHpr-PHO8-CYCt-kanMXmut мають від 7 до 35 разів вищу відповідну ферментативну активність у порівнянні з реципієнтним штамом BY4742 та у 2-10 разів вищу у порівнянні зі штамами, що містять вектор pUC57-delta1_2-ADHpr-PHO8-CYCt-kanMX. Значення активності лужної фосфатази в отриманих рекомбінантних штамів S. cerevisiae добре корелюють з кількістю додаткових копій гена PHO8 у їх геномі. Отже, вектор pUC57-delta1_2-ADHpr-PHO8-CYCt-kanMXmut дійсно забезпечує мультикопійну інтеграцію гена PHO8 у геном S. cerevisiae.

 Рис. 3. Дот-блот гібридизація, що проводилася для визначення кількості копій гена PHO8 у геномі рекомбінантних штамів, де BY4742 – штам дикого типу, що має 1 копію гена PHO8 в геномній ДНК; BY+PHO8 mut – рекомбінантні штами, що містять вектор pUC57-delta1_2-ADHpr-PHO8-CYCt-kanMXmut з модифікованим геном kanMX4; BY+PHO8 delta – рекомбінантні штами, що містять вектор з немодифікованим геном kanMX4.

Проте, незважаючи на досить значне підвищення активності лужної фосфатази в клітинах рекомбінантних штамів з надекспресією гена PHO8, вони не виявляли суттєвого зниження рівня накопичення біомаси (Рис. 5) В зв’язку з цим було вирішено здійснити також надекспресію вкороченої форми гена PHO8, в якій еліміновані нуклеотидні послідовності, що кодують сигнал з 60 амінокислот, який відповідає за доставку синтезованого білка у вакуолярний компартмент.

 Рис. 4. Питома активність лужної фосфатази (мкмоль продукта/мг білка*хв.) в безклітинних екстрактах рекомбінантних штамів S. cerevisiae в порівнянні зі штамом дикого типу. Позначення штамів такі ж, як на Рис.3.

Проте механізм формування активної форми лужної фосфатази доволі складний і включає ряд посттрансляційних модифікацій. По-перше, було показано що лужна фосфатаза синтезується з іРНК як неактивний попередник, що містить C-кінцевий пропептид, який потім відщеплюється за рахунок дії вакуолярної протеази (Klionsky D. and Emr S.D., 1989). По-друге, під час доставки у вакуоль білок-попередник глікозилюється в ендоплазматичному ретикулумі. І, нарешті, також було показано, що одним з кофакторів лужної фосфатази є метал цинк, який зв’язується з ферментом власне у вакуолі (Qiao W. et al. 1985). Всі ці фактори можуть завадити отриманню ферментативно активної цитоплазматичної форми лужної фосфатази. Для того щоб елімінувати інгібуючий вплив С-кінцевого пептида, з вкороченої форми гена PHO8 було також виключено нуклеотидні послідовності, що кодують 22 термінальні амінокислоти.

 Рис. 5. Зміна оптичної густини суспензій клітин під час культивування WT і рекомбінантних штамів S. cerevisiae на середовищі YNB. Позначення штамів такі ж, як на Рис.3.

Для надекспресії вкороченої форми гена PHO8 фрагмент ДНК розміром 1452 пн, що відповідає ВРЗ гена PHO8 S. cerevisiae без початкових 180 і кінцевих 69 нуклеотидів, ампліфікують з використанням праймерів SM28 і SM29 і геномної ДНК BY4742 як матриці. Після очистки цей фрагмент обробляють ендонуклеазами рестрикції BamHI i NotI і клонують в плазміду pUC57-delta1_2-ADHpr-PHO8-CYCt-kanMXmut замість інтактної форми гена PHO8. Отриманий вектор названо pUC57-delta1_2-ADHpr-PHO8trunc-CYCt-kanMXmut. В подальшому його обробляють ендонуклеазою рестрикції AhdI і використовують для трансформації штаму S. cerevisiae BY4742. Селекцію генетицин-резистентних трансформантів проводять на середовищі YPD з додаванням 200 мг/л G418. Наявність в геномі трансформантів експресійної касети ADHpr-PHO8trunc перевіряють за допомогою ПЛР з використанням відповідної пари праймерів (Ко419 та SM29) (див. табл. 1).   

Визначення питомої активності лужної фосфатази у отриманих рекомбінантних штамів (Рис. 6) показало, що штами, які містять вектор pUC57-delta1_2-ADHpr-PHO8trunc-CYCt-kanMXmut мають приблизно в 20-25 разів вищу відповідну ферментативну активність у порівнянні з реципієнтним штамом BY4742 та майже таку саму активність у порівнянні зі штамами, що містять вектор pUC57-delta1_2-ADHpr-PHO8-CYCt-kanMXmut з інтактною формою гена PHO8, однак, на відміну від останніх, рекомбінантні штами що містять вкорочену форму гена PHO8 виявляють значну затримку в накопиченні біомаси на перший день культивації (Рис. 7).

Рис. 6. Питома активність лужної фосфатази (мкмоль продукта/мг білка*хв.) в безклітинних екстрактах рекомбінантних штамів S. cerevisiae в порівнянні зі штамом дикого типу. BY4742 – штам дикого типу; BY+PHO8 mut – рекомбінантні штами, що містять вектор pUC57-delta1_2-ADHpr-PHO8-CYCt-kanMXmut з інтактною формою гена PHO8; BY+PHO8 trunc – рекомбінантні штами, що містять вектор з вкороченою формою гена PHO8.

Рис. 7. Зміна оптичної густини суспензій клітин під час культивування WT і рекомбінантних штамів S. cerevisiae на середовищі YNB. Позначення штамів такі ж, як на Рис. 6.

.

 


 

А также другие работы, которые могут Вас заинтересовать

15200. Мәшһүр Жүсіп 78 KB
  Мәшһүр Жүсіп Атақты ақын ғұлама оқымысты Мәшһүр Жүсіптің көп қырлы талант екені елге мәлім. Қаршадайынан оқыған оқып қана қоймай көңіліне мол дүние тоқыған білімдар. Ақынның 1907 жылы үш бірдей кітабы – €œКөп жасағаннан көрген бір тамашамыз€ €œХалахуал€ €œСары...
15201. Міржақып Дулатов 82 KB
  Міржақып Дулатов Халық жүрегіне ерекше қымбат тұлғалардың бірі – Міржақып Дулатұлы. Жақаңның бар ғұмыры халқымен тығыз байланысты. Осы арада бір ғана жәйтке тоқталсақ қазақтың азаттық қозғалысының алғашқы сәулесіндей жылт еткен €œСерке€ газетіндегі €œЖастарғ
15202. Молда Мұқан Балтекейұлы 50.5 KB
  СЫР БОЙЫНЫҢ АҚЫНЫ Ш. У. Қасымова № 45 Ақ Орда мектепгимназия Шиелі ауданы Қызылорда облысы Сырдың елі – жырдың елі. Сыр өңірі қашаннан –ақ ақын жыраулар мен шайырлардан данышпан бишешендерден қалған асыл мұраларды көздің қарашығындай сақтап оны ұрпақтанұ...
15203. Мұрат Мөңкеұлы 46 KB
  Бүкіл ұлттың Мұраты Кеңес кезінде €œзар заман€ ақындарының ішінде жеткіліксіз зерттеген ақындардың бірі – Мұрат Мөңкеұлы. 194050 жылдар арасында жарық көрген мектеп оқулықтарында енгізіліп жүрген Мұрат ақын 1947 жылғы атышулы қаулыдан кейін зерттеу объектісінен мүлде ...
15204. Олжас Сүлейменов 62.5 KB
  Олжас Сүлейменов. Олжас Сүлейменов 1936 жылы Алматы қаласында әскери қызметкердің отбасында дүниеге келген. Алдымен әлФараби атындағы Қазақтың ұлттық университетін сонан соң Мәскеудегі М. Горький атындағы Әдебиет институтын бітірген. Орыс тілінде жазады. Тұңғыш өл
15205. Пайғамбар аттас ақын - Жүсіп Қыдыров 46.5 KB
  Махаббат деп түсінді мына әлемді... Талантты лирикақын Жүсіп ҚЫДЫРОВ рухымен сырласу Жүсіп міне сен көре алмай кеткен жаңа мыңжылдықтың наурыз айы тағы да келді. Бұл сен туған ай. Егер тірі болсаң ол сенің жетпісінші көктемің болар еді. Әттең жазмыштан озмыш жоқ еке...
15206. С.Бегалин - халықтың сүйікт жазушысы 287.5 KB
  Сүйіктісі халықтың Жүрегіңнің алаулатып жалынын Тамыршыдай дарындыны таныдың. Қабыл болып ізгі тілек ақ батаң Алдым шексіз ғибрат мол тағылым. Танымастай өзгерді ел жер кейпі Озбырлықтың мәңгүрт басы еңкейді. Семейдегі жарылыстың үні өшіп Абыра...
15207. Сағат Әшімбаев 188 KB
  Заманынан озып туған азамат еді Сағат Әшімбаев туралы Қоғамды қозғайтын адам санасын өзгертетін тұлғалар болады. Олар өзінің қатарынан заманынан озық туады. Өткен ғасырдың алпысыншы – сексенінші жылдарының арасы қазақ руханиятына дарындыларды үйіптөгіп
15208. Саттар Ерубаев 146.5 KB
  Саттар Ерубаев 1914-1973 Қысқаша өмірбаяны: Саттар Ерубаев 1914 жылы Түркістан ауданыныда дүниеге келді. Балалар үйінде тәрбиеленген. 1927 жылы Түркістан ауданы Комсомол колхозында қызмет істейді. ҚазКСР Оқу халық комиссариатының жоғары оқу орнында даярлау курсы...