43835

Получение биологически активного hrNGF человека путём бактериального синтеза в клетках Escherichia coli

Дипломная

Биология и генетика

Объект исследования – рекомбинантный человеческий фактор роста нервов hrNGF Цель дипломной работы – получение биологически активного hrNGF человека путём бактериального синтеза в клетках Escherichi coli. Сконструированы гибридная система экспрессии hrNGF в которой в качестве белка партнёра выступал белок SUMO.

Русский

2013-11-07

2.32 MB

10 чел.

Реферат

Исупов С. В. Фактор роста нервов человека: Гетерологичная экспрессия  гена бета NGF в клетках E. coli и разработка методов выделения  и очистки белка фармокопейного  качества. / Центр ”Биоинженерия РАН”, лаборатория готовых лекарственных форм: рук. к.б.н. Шульга А. А. – Москва, 2012. − 181 с., 40 рисунков, 29 таблиц, 67 источников, 10 приложений.

НЕЙРОТРОФИНЫ, ФАКТОР РОСТА НЕРВОВ (NGF), P75 - РЕЦЕПТОР, TRK  - РЕЦЕПТОР, НЕЙРОНЫ, ДНК, ТРАНСФОРМАЦИЯ, ВЫДЕЛЕНИЕ, ОЧИСТКА.

Объект исследования – рекомбинантный человеческий фактор роста нервов (hrNGF)

Цель дипломной работы – получение биологически активного hrNGF человека путём бактериального синтеза в клетках Escherichia coli.

Сконструированы гибридная система экспрессии hrNGF, в которой в качестве белка партнёра выступал белок SUMO.  Гибридный белок получали в штамме  E. coli BL-21(DE3) в количестве 1 г/л культуры в виде «истиных» телец включения. С целью повысить выход белка при культивировании были оптимизированы режимы температуры, время и состав среды.  Полученный гибридный белок, а в дальнейшем целевой белок очищали с помощью ионообменной хроматографий. Активность hrNGF определяли в экспериментах по in vitro связыванию с внеклеточным доменом рецептора p75. В результате проделанной работы был разработан эффективный и простой метод получения высокоочищенного активного hrNGF  с выходом 5 мг/л клеточной суспензии.

Введение

Фактор роста нервов (nerve growth factor, NGF) представляет собой небольшой секретируемый белок семейства нейротрофинов. Этот белок синтезируется в клетке в форме пробелка, который кроме участка, соответствующего зрелому фактору, содержит сигнальный пептид и пропептид. Он кодируется у человека геном NGF на коротком плече 1-й хромосомы Впервые  его деятельность была обнаружена итальянским нейробиологом Леви-Монтальчини  в опухолевых тканях в 1950 году, за что  она в 1986 году получила Нобелевскую премию по физиологии и медицине.

NGF регулирует выживаемость симпатических и сенсорных нейронов периферической нервной системы, а также холинергических нейронов  ЦНС Кроме того, ФРН влияет на выделение медиаторов (ацетилхолина, глутамата и др.) в нервно-мышечных синапсах и синаптосомах гиппокампа.

Фактор роста нервов является белком, определяющим развитие симпатической нервной системы, благодаря стимуляции нервных клеток.  NGF, взаимодействуя со своими рецепторами, отвечает за запуск множества метаболитических путей внутри клетки, тем самым обладая большим терапевтическим потенциалом для лечения болезней в которых задействованы эти пути.

Современные знания  о данном белке позволяет его использовать при коррекции и лечение заболеваний центральной нервной системы, связанных с психическими расстройствами (слабоумие, депрессия, шизофрения, аутизм, синдром Ретта, анорексии и булимии, болезни  Альцгеймера). Кроме того он играет важную роль в сердечно – сосудистых заболеваниях (атеросклероз коронарных артерий, ожирение, сахарный диабет 2 типа). Существует доказательство того, что NGF может быть полезен в лечении кожных язв и язв роговицы.

Все выше сказанное говорит о том, что создание лекарственных препаратов на основе фактора роста нервов является социально значимой проблемой. Данный белок практически невозможно выделить из природных источников. Поэтому  перспективным является  получение биологически активного фактора роста нервов в гетерологичных экспрессионных системах. Анализ литературы по данной проблеме показывает небольшое количество информации, что говорит об актуальности и перспективе получения рекомбинантного NGF.

Целью данной работы является получение высокоочищенного фактора роста нервов человека путём бактериального синтеза в клетках Escherichia coli для дальнейшего использования в фармацевтических целях.

Для достижения поставленной цели необходимо было решить следующие задачи:

  1.  Получение векторной конструкции, обеспечивающей экспрессию гибридного белка hrSNGF  в клетках Escherichia coli. 
  2.  Получение штамма-продуцента и подбор условий культивирования.
  3.  Очистка гибридного а в дальнейшем целевого белка hrNGF.

Дипломная работа выполнена в лаборатории готовых лекарственных форм Центра «Биоинженерия» РАН

 

Обзор и анализ научно технической и патентной информации.

  1.  Нейтрофины.
  2.  Общая характеристика.

Наиболее сильное трофическое влияние на все основные процессы жизнедеятельности  нейронов оказывают нейротрофины - регуляторные белки нервной ткани, которые синтезируются в ее клетках. Они действуют локально в месте высвобождения и особенно интенсивно индуцируют ветвление  дендритов (арборизацию) и рост  аксонов (спрутинг) в направлении клеток-мишеней. Синаптический спрутинг, обеспечивающий "реусиление" существующих нейрональных токов и образование новых полисинаптических связей, обусловливает пластичность нейрональной ткани и формирует механизмы, участвующие в восстановлении нарушенных неврологических функций [1,2].

В результате направленного поиска нейротрофных факторов был выделен и очищен до гомогенного состояния первый представитель этого класса белковых молекул -  фактор роста нервов. Это открытие, впоследствии отмеченное присуждением Нобелевской премии, повлекло бурное развитие данного направления и открытие других нейротрофных факторов. Все они играют важную роль в процессах развития и функционирования нервной системы, а также, что особо важно для практической медицины, в  регенерации поврежденных нейрональных структур [3].

NGF явился первым известным нейротрофным фактором, и родоначальником особой и наиболее специфической по своей биологической активности группы факторов, получившей название семейства нейротрофинов.  Это семейство объединяет белки, сходные по структуре с NGF, - небольшие положительно заряженные молекулы членов этого семейства имеют высоко гомологичные аминокислотные последовательности и способны образовывать гомодимеры.  Димеризация является непременным условием для осуществления биологических функций нейротрофинов [4].

Наиболее изучены нейротрофины, близких друг к другу по структуре:  фактор роста нервов (NGF) ,  фактор роста, выделенный из головного мозга (BDNF) , и  нейротрофин-3 (NT-3), а также NT-6 и  NT-4/5. В развивающемся организме они синтезируются клеткой-мишенью (например, мышечным веретеном), диффундируют по направлению к нейрону, связываются с молекулами рецепторов на его поверхности, что приводит к активному росту аксона. В результате аксон достигает клетки-мишени, устанавливая с ней синаптический контакт. Факторы роста поддерживают жизнь  нейронов , которые в их отсутствие не могут существовать [5].

Нейротрофины синтезируются в клетке вформепрепробелков, которые, кроме участка,соответствующего зрелому фактору, содержатсигнальный пептид и пропептид размером 105–120 аминокислотных остатков (а.к.о.). Последовательности зрелыхнейротрофиновчеловека,состоящие из 119–121 а.к.о., высокогомологичны и имеют около 55% идентичных а.к.о.[7]. Все зрелые белки выделены из природныхисточников в виде негликозилированныхгомодимеров. По своей пространственной структуре

нейротрофины относятся к семейству белков,пространственная укладка которых известна как«цистиновый узел». Основу этой укладки составляет образованный двумя дисульфиднымисвязями мегацикл, пронизанный еще однойдисульфидной связью [8].

Процессинг молекулы предшественникапроисходит в консервативном для всех членовсемействанейротрофинов сайте после последовательности Arg-Xaa-Arg/Lys-Arg. Этот процесс осуществляют субтилизин/кексин-подобные пробелок-конвертазы: фурин, PACE4 иPC5/6-B [9]. Функциональная роль пропептидовнейротрофинов до настоящего времени не установлена. Высказано предположение, что онимогут выполнять функции фолдинг-ассистентов, определяя формирование пространственной структуры нейротрофических факторов.

Становится все более очевидным, что наряду с нейротрофинами почти все известные классические и вновь открываемые  факторы роста в определенных условиях могут оказывать  трофическую поддержку определенных групп нейронов. По всей вероятности, это связано с тем, что в нервной системе присутствуют рецепторы большинства трофических факторов, а внутриклеточные системы передачи сигналов в ядро, используемые различными рецепторами, взаимно перекрываются.  Однако роль других нейротрофных факторов в развитии и функционировании нервной системы несоизмерима с масштабами влияния нейротрофинов. Хотя число последних невелико, их биологическая активность, направленная на установление четкой комплексной сети связей в нервной системе, необычайно сложна и многогранна. К настоящему времени стало очевидно, что функциональное разнообразие осуществляется не с помощью огромного набора разнообразных нейротрофинов, как казалось вначале, а путем сложного взаимодействия небольшого их числа [6].

Основным методическим подходом, позволившим углубить наши знания о функциях нейротрофинов, стало изучение способности нейронов выживать в первичных диссоциированных культурах в присутствии рекомбинантных нейротрофинов .

Большая часть выводов, сделанных на основании экспериментов с первичными культурами нейронов, получила подтверждение при анализе нейронных популяций у животных с направленно инактивированными генами нейротрофинов и их рецепторов. Было установлено, что те нейротрофины, которые необходимы для определенных групп нейронов invivо, способны поддерживать выживаемость первичных культур этих же самых нейронов invitro. Эксперименты с культурами нейронов показали, что разные типы нейронов требуют разных нейротрофинов и что некоторые клетки на определенном этапе индивидуального развития чувствительны сразу к нескольким факторам, а другие ни к одному из известных [7].

Развитие нервной системы сопровождается сложным последовательным переключением чувствительности к нейротрофинам в определенных популяциях нейронов. Очевидно, что такая сложная система требует регуляции не только, и даже не столько на уровне индукции сигнала (т.е. продукции нейротрофинов), но и на уровне восприятия нейронами этого сигнала (т.е. продукции рецепторов) .

Нейротрофины взаимодействуют с двумя известными типами специфических рецепторов cнизкоафинным рецептором p75NTR и высокоафииными протеин-тирозинкиназными (Trk) рецепторами TrkA, TrkB и TrkC. При этомNGF является предпочтительным лигандомдляTrkA, BDNF и NT-4/5 – для TrkB, а NT-3 – дляTrkC. При определенных условиях NT-3 способен взаимодействовать с TrkA и TrkB, но сболее низкой аффинностью, чем с TrkC.Рецептор р75 связывает как зрелые, так и про-формы нейротрофинов. При этом он способенсвязывать все типы нейротрофинов (NGF,BDNF, NT-3 и NT-4/5) с примерно равнойаффинностью [8].

Кроме детально изученных эффектов нейротрофинов на нервную систему, в последнее время появились новые работы, демонстрирующие более широкий спектр регуляторных влияний этих факторов роста, и в частности их эффекты на иммунную систему. Kannanetal. (1994, 1996) установили, что NGF принимает участие в симпатической иннервации лимфоидных органов, в которых была также выявлена экспрессия нейротрофиновых рецепторов: тимуса, селезенки, сумки Фабрициуса, лимфоузлов и пейеровых бляшек [9].

1.2  Нейротрофины в ЦНС

Особенный интерес представляет нахождение популяции клеток, чувствительной к NGF, в ЦНС. Таковыми являются холинергические нейроны, которые расположены в базальной области переднего мозга и которые иннервируют несколько различных структур, в том числе гиппокамп — область ЦНС, которая, как считают, связана с процессами памяти и обучения. Если аксоны этих нейронов у взрослой крысы перерезать, то клетки погибают. Однако, если после перерезания вводить в ЦНС NGF, то клетки выживают после аксотомии. Число этих клеток, которые окрашиваются маркерами холинергических нейронов, уменьшается с возрастом, вместе со способностью крыс запоминать лабиринт и выполнять другие пространственные задачи. Если NGF вводится взрослым крысам, число клеток, которые окрашиваются, увеличивается и улучшается выполнение крысами пространственных задач. Эти наблюдения показывают, что выживание и рост нейронов в ЦНС, скорее всего, зависит от факторов, которые одинаковы или близки к тем, которые были идентифицированы для периферических нейронов. Полученные результаты позволяют предполагать, в терминах молекулярной биологии, возможные дефекты этих факторов, которые могут привести к нарушениям развития мозга, и возможные пути борьбы с этими дефектами.

ВDNF и NT-3 широко распространены в ЦНС как во время развития, так и у взрослых. Клетки коры и гиппокампа, скорее всего, нуждаются в МНФ и NT-3 для выживания, хотя изменения в выживаемости клеток в ЦНС трудно проследить. МНФ, как было показано, влияет на рост и сложность ветвления аксонов и дендритов в развивающейся ЦНС. Анализ мышей с генетическим дефицитом представляет многообещающий подход к пониманию роли нейротрофинов в развивающейся нервной системе .

Нейротрофины также могут играть определенную роль и в ЦНС взрослых животных. Физиологическая активность вызывает экспрессию определенных нейротрофинов в разных областях ЦНС и в ответ на различные стимулы. В свою очередь, нейротрофины, как было показано, способны влиять на физиологическую активность, облегчая синаптическуюпередачу и увеличивая или уменьшая возбудимость нейронов посредством регуляции экспрессии ионных каналов.

2. Рецепторы нейтрофинов.

2.1Высокоаффинный рецептор к нейротрофинам pl40 prototrk

Нейротрофины связываются с высокоаффиным рецептором pl40 prototrk с активностью (Кd = 10-11 М). Результаты биологических проб показывают, что эффекты нейротрофинов на выживание клеток и на рост отростков нервов обусловливаются высокоаффинными рецепторами.

Хотя высокоаффинные рецепторы к NGF обычно расположены только на нейронах, они были первоначально обнаружены в клетках карциномы толстой кишки человека, как часть продукта синтеза онкогена trk(онкогенами называют гены, которые управляют трансформацией клеток). Аналог онкогена trk, находящийся в нормальных клетках, кодирует белок с массой около 140 кДа, называемый pl40prototrk или просто Trk. Существуют по крайней мере три члена семейства про-онкогенов trk, каждый из которых является высокоаффинным рецептором для одного или нескольких нейротрофинов: TrkA — рецептор к NGF и NT-6; TrkB, по видимому, является рецептором к МНФ и NT-4/5, a TrkC является рецептором к NT-3[].

Рецепторы нейротрофинов TrkA, TrkB и TrkC имеют общую архитектуру.  Общая структура рецепторов представляет собой два B–листа, упакованные друг с другом в верхней части в виде сэндвича. Каждый из листов содержит четыре нити (A, B, C, D)в одном листе и G, F, С, С| в другом. Петли AB, EFи CC| находятся на С  терминальном конце домена, а BC, DEиFG на противоположном конце [].

Их внеклеточная часть состоит из цистеин –богатого кластера(1 домен), трёх лейцин – богатых повторов (2 домен), второго цистеин –богатого кластера (3 домен) и и двух иммуноглобулинподобных доменов (4,5 домен).Внеклеточная часть, связанна одной трансмембранной спиралью  с внутриклеточным тиразинкиназным доменом. Гомологичностькиназных областей составляет более 75%, в то время как сходство внеклеточной части около 50%Во всех трех рецептарахнаиболее консервативным является пятый домен, содержащий 9 из 11 идентичных остатков. Кристаллические структуры этой области в TrkA, TrkB и TrkC, показывают,что этот сегмент включает в себя EF цикл, отвечающий за непосредственное образование лиганд – рецепторного комплекса[].

Рисунок 1 –Схема кристаллической структуры Trk рецепторов

Биологическое значение других областей, особенно четвертого домена, в настоящее время мало изучено. Ряд исследований свидетельствует о том, что наличие четвертого доменанеобходимо  для эффективного образования и упаковки лиганд связывающего домена.  Точная роль лейцин богатых повторов тоже пока остается спорной, но ученые предполагают, что они являются важным компонентом для связывания лиганда на TrkAи TrkB Вдругом исследовании, эти области обеспечивают высокое сродство связывания NT-3 TrkC,но являются не обязательным NGF в TrkA[].

2.2 Низкоаффинный рецептор к нейротрофинам p75LNTR.

Все нейротрофины связываются с относительно одинаковой и низкой активностью (Кd= 10--9 М) с мембранным рецептором, который был первоначально описан как низкоаффинный быстрый рецептор NGF, или p75NGFR; более правильно называть этот рецептор низкоаффинным рецептором к нейротрофинам, или p75LNTR этот рецептор экспрессируется как в нейрональных, так и в ненейрональных клетках [].

Наряду с трофическим действием,  NGF может вызывать апаптоз в определенных типах клеток, взаимодействуя с p75LNTR[]. Процесс активации рецептора или  определенного лигандного сайта до сих пор не выяснен. Биологическая  активность данного рецептора зависит от нейротрофина, запускающего лиганд а также от наличия на поверхности клетки Trk рецепторов.При взаимодействии  с Trk – негативнымиклетками, NGF,связывается с p75нейтрофинным рецепторомивызываетаппоптоз клетки. В присутствии Trkрецепров, p75LNTR повышает афинностьсвязывания NGFcTrkA, создавая сайты связывания c“ высоким сродством”[].

Рецептор p75NTR представляет собой трансмембранный гликопротеин, который содержит небольшой цитоплазматический домен смерти. Структура, которая была найдена  во многих другихапоптозиндуцирующих рецепторах, таких как Fas и p75TNF. Структура  данной области p75NTR была определена с помощью ядерно-магнитного резонанса. Она представляет собой шесть спиралей, расположенных компактно в виде глобулы. В отличии от цитоплазматического домена,  экспериментальных данных о структуре внеклеточной части p75NTR в настоящее время не сообщается. Тем не менееструктура рецептора гомологична известным структурам TNF и Apo2L\TRAIL.Эти рецепторы имеют удлиненную, палочковидную форму, состоящую из вариабельного числа цистеин – богатых повторов, каждый из которых содержит три дисульфидныхмостика.Эктодомен рецептора p75NTR состоит из четырехцистеин-богатых повторов,  которые являются обязательнымиструктурами для обеспечения высокой аффинности с NGF. С помощью мутагенеза данных сайтов было определенно, что наибольшее значение в обеспечении аффиности играет вторая цистеин–богатая область [].

Рисунок 2 - Схема кристаллической структуры низкоаффиного рецептора p75LNTR.

  1.  Фактор роста нервов.
  2.  История открытия

Впервые деятельность фактора роста нервов была обнаружена Леви-Монтальчини и Гамбургером в опухолевых тканях в 1950 году, при совместном инкубировании клеток спинальных ганглиев и саркомы. В результате чего наблюдался интенсивный рост аксонов по сравнению с контрольной группой без опухолевых клеток. Стало ясно, что эффект роста обусловлен каким то веществом, выделяемым клетками опухоли. Одно из предположений состаяло в том, что это нуклеопротеид, и поэтому решили исследовать действие змеиного яда на эффект роста, поскольку змеиный яд содержит фермент расщепляющие нуклеопротеиды. Результат оказался неожиданным. В 1959 году Кохен установил, что змеиный яд сам по себе вызывает рост аксонов в культуре. Это говорит о том, что змеиный яд содержит фактор роста нервов. Поскольку ядовитая железа змей является гомологом подчелюстной железы теплокровных, в 1960 году Кохен исследовал действие гомогената подчелюстной слюнной железы мыши на рост аксонов в культуре. Оказалось, что подчелюстные железы мышей являются еще более богатым источником фактора роста нервов. В этих интереснейших открытиях большую роль сыграла случайность. Случайно был открыт NGF в змеином яде. Отсюда был сделан вывод о возможном наличии его в подчелюстной железе мыши, которые являются гомологом змеиного яда. Оказалось, что исследователям необычайно повезло: мышь единственный известный вид, у которого содержания NGFв слюнных железах столь высоко. У других видов содержание его в сотни и тысячи раз меньше [].

Зрелая форма NGF была очищена до гомогенного состояния из подчелюстной железы мыши в 1969 году Бочини и Ангелити. Далее NGF был обнаружен  в самых разнообразных органах и тканях, а также вдругих видах, включая человека [].

3.2 Молекулярная характеристика.

Фактор роста нервов синтезируется в клетке в форме пробелка, который кроме участка, соответствующего зрелому фактору, содержит сигнальный пептид и пропептид. Он кодируется у человека геном NGF на коротком плече 1-й хромосомы [].

Зрелый белок состоит из пяти субъединиц: две альфа, одна бета и две гамма. Ответственна за эффект роста аксонов только бета субъединица. Функциональное значение альфа и гамма субъединиц пока не известно. Расшифровка последовательностей бета - субъединицы NGF показала, что 50 % аминокислот стоят в тех же положениях, что и в молекуле инсулина, что указывает на генетическое родство этих двух молекул[].

Фактор роста нервов (NGF) содержит 118 аминокислотных остатков, структурированных в две полипептидные цепи, с молекулярной массой 13 кД каждая:

NH2-ser-ser-thr-his-pro-val-phe-his-met-gly-glu-phe-ser-val-cys-asp-ser-val-ser-val-trp-val-gly-asp-lys-thr-thr-ala-thr-asn-ile-lys-gly-lys-glu-val-thr-val-leu-ala -glu-val-asn-ile-asn-asn-ser-val-phe-arg-gln-tyr-phe-phe-glu-thr-lys-cys-arg-ala-ser-asn-pro-val-val-ser-gly-cys-arg-gly-ile-asp-ser-lys-his-trp-asn-ser-tyr-cys-thr-thr-thr-his-thr-phe-val-lys-leu-thr-thr-asp-glu-lys-gln-ala-ala-trp-arg-phe-ile-arg-ile-asn-thr-ala-cys-val-cys-val-leu-ser-arg-lys-ala-thr-arg-COOH

Последовательности Cys [15] -Cys [81], Cys [58] -Cys [112], Cys [68] -Cys [110] соединены S-S-мостика.

  1.  Третичная структура.

Третичная структура NGF впервые была показана с помощью метода рентгеновской кристаллографии и опубликована в 1991 году McDonaldc со авторами в журнале Nature. Структура мономера белка имеет вытянутую форму сцентральной частью молекулы, содержащей две пары витых антипараллельно направленных βнитей. Три петли, содержащие β шпильки, находятся на одном конце молекулы, в то время как на противоположном конце молекулы находятся обратный поворот  и цистеиновый узел, который стабилизируют структуру молекулы. Цистеиновый узел состоит из трех дисульфидных связей. Две из них, вместе с белковой основой, которая соединяет цистеин, образуют замкнутое кольцо, которое пронизано третьим дисульфидным мостиком. Два протомера ориентированы друг к другу по типу “голова к голове” и образуют димер вокруг центральной оси. Взаимодействие в основном  происходит через гидрофобные связи  и  согласуется с жесткой нековалентной ассоциацией, которая характеризует β димер. При образовании димера, фактор роста нервов приобретает гантель - образную форму. Два центральных β слоя из обоих мономеров при взаимодействии друг с другом образуют ручку гантели. Остатки этих четырех β нитей отвечают за большинство взаимодействий, стабилизирующих димер. В последующем было установлено, что структуры  BDNF, NT – 3 иNT – 4 имеют высокую степень гомологии с NGF.

Биологическая активность фактора роста нервов проявляется только в форме димера. Мономер биологическую активность сохранять не может.     Помимо аминокислот  NGF включает большую часть ароматических остатков, в том числе три триптофана и один из двух тирозинов.  Заряженные аминокислоты относительно равномерно распределены по всей последовательности.  Две из трех петель найдены в верхней части молекулы. Они богаты основными остатками, но содержат и не большое количество кислых остатков, а также сайт направленного мутагенеза [].

            

Рисунок 3 – Структура мономера NGF(слева) и димера NGF (справа)

Рисунок 4 – Схематическое изображение аминокислотных остатков (слева) и ароматических (справа) остатковNGF

3.4 Механизм взаимодействия NGF с рецепторами.

Кристаллическая  структура NGFTrkAd5 комплекса показала, что димерNGFсвязывается через центральную область β слоя с 5 доменом TrkA. Ориентация комплекса по отношению к мембране, определяется положением Cтерминального конца TrkAd5.При взаимодействии C конца TrkA с NGF происходит поворот L2 и L4 петель, что способствует связыванию NGFс рецептором.При этом цистеиновый узел и N, а также C конец располагаются в верхней части молекулы NGF.Связывание p75NTR происходит в нескольких местах. Наиболее важным участком для связывания p75NTR является L3 петляиCконцецNGF, которые ориентированы в одном направлении. Этот домен находится сверху молекулы и состоит в основном из положительно заряженных остатков.  Данная конструкция комплекса NGFTrkAd5 согласуется с идеей, что фактор роста нервов может одновременно связываться с TrkA и p75NTR. Вторым участком для связывания низкоаффиного рецептора являются положительно заряженные остатки петель L1 и L4, находящиеся в нижней части молекулы[] .

        

Рисунок 5 – Схема кристаллической структуры NGFTrkAd5 комплекса (слева) и тройного комплекса NGFTrkAd5 - p75NTR (справа)

Связывание димера фактора роста нервов с двумя молекулами рецептора TrkA приводит к тому, что домен внутриклеточного белка тирозинкиназы каждого из TrkA рецепторов фосфорилирует остатки тирозина другого TrkAрецептора. Это запускает четыре внутриклеточных сигнальных каскада, которые приводят к росту и дифференцировке. Активация фосфоинозитол-3-киназы (PI 3-kinase) способствует удлинению отростков и их выживанию. Фосфорилирование тирозина SNT приводит к дифференцировке. Активация фосфолипазы C-γ (PLC-τ) стимулирует MAP киназы, которые индуцируют экспрессию генов, дифференцировку и рост как непосредственно, так и через фосфорилирование RSK. MAP киназа также активируется через сигнальный каскад, который включает связывание белков SHC, Grb-2, SOS и Ras, а также киназRaf и МЕК. — S— Р04 — фосфорилированиесерина; — Т — Р04 — фосфорилированиетреонина; — Y — Р04 — фосфорилирование тирозина [].

 

Рисунок 6 - Механизм взаимодействия NGF с  TrkA

Механизмы действия низкоаффинного рецептора, который не имеет внутриклеточных доменов, в настоящее время не изучены. В некоторых клетках он может взаимодействовать с высокоаффинным рецептором во время связывания нейротрофинов. В других клетках, особенно в тех, в которых нет высокоаффинных рецепторов, он может управлять гибелью клеток или обеспечивать механизм ограниченной диффузии для установления высокой локальной концентрации нейтротрофинов, что необходимо для регенерации периферического нерва.

3.5 Захват и ретроградный транспорт NGF.

То, что от NGF зависит выживание нейрона, говорит о том, что его действие происходит в теле клетки. Это было доказано при выращивании симпатических нейронов в специальных камерах, состоящих из трех отсеков. В центральном отсеке, куда помешаются нейроны, находился NGF, при его отсутствии нейроны гибнут. Однако, после того, как отростки нейрона достигают боковых отсеков камеры, NGF может быть удален из центрального отсека и клетки остаются живыми, при условии, что в боковых отсеках NGF остается. Это дает основания полагать, что трофические эффекты NGF на развивающиеся нейроны могут передаваться в виде ретроградного транспорта NGF от нервных терминалей в тела клеток. Исследования, проведенные на взрослых животных с радиоактивно меченым NGF, показали, что он активно захватывается в нервные терминали и активно транспортируется ретроградно в сому. Взрослым нейронам NGF не нужен для выживания, однако он регулирует, среди всего прочего, синтез адреналина, индуцируя образование двух ферментов, необходимых для его синтеза: тирозингидроксилазу и дофамингидроксилазу. При повреждении транспорта NGF взрослого нейрона уровень этих ферментов падает[].

Рисунок 7 - Фактор роста нерва и выживание веточек аксонов клеток симпатических ганглиев, растущих в культуре клеток.

(А) Нейроны, полученные из неонатального симпатического ганглия и помещенные в центральную секцию, посылают свои отростки под тефлоновым разделителем и в соседние секции; все секции содержат NGF.

(В) После начального роста отростков удаление NGF из центральной секции в течение 20 дней не приводит ни к какому эффекту; нейроны в центральной секции используют NGF, который ретроградно транспортируется из их терминалей, расположенных в боковых секциях.

(С) После начального роста отростков удаление NGF из левой секции вызывает дегенерацию нервных отростков в этой области,а те, которые находились в секции, содержащей NGF, остаются интактными.

3.6 Функции NGF в организме.

3.6.1 Действие NGF на нервные клетки.

Фактор роста нервов вызывает дифференцировку нервных клеток, а также ускоряет рост и улучшает выживание аксонов. Причем этот рост направленный, поскольку аксоны симпатических клеток обладают хемотаксисом. Иннервация ткани симпатической системой зависит от того способна ли ткань синтезировать и выделять NGF. NGF является указателем для роста симпатических аксонов, определяющим наличие или отсутствии симпатической иннервации данной ткани [].

3.6.2 Значение  NGF в метаболизме.

Рост нервных клеток под воздействием NGF был исследован с биохимической точки зрения. Кохен впервые показал влияние фактора роста нервов, очищенного из змеиного яда на глюкозное окисление эмбриональных сенсорных ганглиев, культивированных в пробирке. Он отметил, что для образования нервных волокон необходима глюкоза или маноза. Глюкоза не может быть полноценно заменена другими субстратами, лишь лактат и пируват могут её частично заменить. Было установлено, что NGF увеличивает окисление глюкозы на 20-40 %. Подобные результаты были получены и при использовании NGF, очищенного из подчелюстной железымыши. При введении фактора роста нервов в естественных условиях в организм новорожденных животных, так же происходит стимуляция окисления глюкозы. Контрольные эксперименты,  проведённые Кохеном с различными нервными тканями, которые не взаимодействовали с NGF, не показали изменений в метаболизме глюкозы[].

Также фактор роста нервов принимает непосредственное участие в стимулировании липидного синтеза в эмбриональных сенсорных и симпатических ганглиев. С помощью тонкослойной хроматографии с последующей авторадиографией было установлено, что при культивировании ганглиев совместно с NGF синтез липидов увеличивается на 60-90 % по сравнению с контрольной группой без фактора роста нервов. Увеличение скорости образования липидов в NGF – стимулированных клетках может быть связано с повышением доступности NADPH2 ( кофактор, участвующий в биосинтезе жирных кислот) и с индукцией новых молекул  данного  фермента. Интересно отметить, что стимулирующее действие NGF на синтез липидов полностью пропадает под воздействием актиномицина-D в дозе, не подавляющей значительно скорости образования (включения в состав мембраны/формирования) липидов в контрольных ганглиях [].

Рост восприимчивых нервных клеток, вызванный взаимодействием с NGF, сопровождается быстрым увеличением синтеза белка внутри клеток. Коуэн впервые рассмотрел включение меченного C – лизина в белок эмбриональных сенсорных ганглиев in vitro. Под влиянием NGF включение C–лизина увеличивается на 58-72% в двадцати часовой период. Более обширные исследования по влиянию NGF на синтез белка проводили с эмбриональными сенсорными и симпатическими ганглиями курицы и верхними шейными ганглиями новорожденных мышей. Анализ растворимых белков в эмбриональных сенсорных ганглиях, инкубированных в течении различных промежутков времени, в присутствии радиоактивных предшественников, показал что NGF селективно стимулирует синтез некоторых классов белков. Экспериментально установлено, что фактор роста нервов стимулирует синтез  более крупных, имеющих низкий pH белков и отрицательный заряд. Стимуляция синтеза РНК, о чем свидетельствует включение радиоактивных предшественников, является одним из первых метаболических эффектов вызванных воздействием NGF на ганглии, которые культивируют in vitro, что в последствии стимулирует синтез белка [].

3.6.3 Участие NGF в патологических состояниях.

Фактор роста нервов является белком, определяющим развитие симпатической нервной системы, благодаря стимуляции нервных клеток.  Как было сказано выше, NGF отвечает за запуск множества метаболитических путей внутри клетки, тем самым  обладая большим терапевтическим потенциалом для лечения болезней в которых задействованы  эти реакции.

Впервые клиническое действие NGF, было изучено и испытанно при диабетической полинейропатии (ДПН), которая является одним из поздних осложнений сахарного диабета (CД),  Она развивается в различные сроки практически у всех больных сахарным диабетом и приводит к серьезным расстройствам функционирования различных внутренних органов и систем, таких как сердечно-сосудистая, пищеварительная, мочевыводящая системы. ДПН также проявляется нарушениями потоотделения, аккомодации и адаптации зрачка, метаболическими изменениями. Патофизиологические механизмы, лежащие в основе развития ДПН, до сих пор полностью не изучены. Принято считать, что в патогенезе ДПН, большое значение имеют ишемия нервных волокон и метаболические изменения, происходящие в них под воздействием гипергликемии. При введении больным NGF происходит восстановление и значительное улучшение функционирования миелинизированных нервных волокон [].

В настоящее время изучается влияние NGF на зрительный нерв, который поражается при глаукоме. Актуальность данной темы велика, так как глаукома является тяжелым заболеванием глаз, которое выражается в повышении внутриглазного давления, дегенерации сетчатки и полной слепоте. Проведенные опыты показывают, что у животных, получавших длительное время фактор роста нервов, при крысиной модели глаукомы улучшается поле зрения, оптические функции нервов, контрастность, чувствительность и острота зрения. Такой положительный эффект достигается за счет образования комплекса NGFTrkA  в результате развивается нейропротекторное действие и происходит ингибирования апоптоза ганглиозных клеток сетчатки. Данные результаты указывают на перспективы терапевтического лечения глаукомы человека с помощью препаратов, содержащих NGF [].

Также стоить отметить, что фактор роста нервов может играть ключевую роль в восстановлении поврежденных нервных клеток у детей больных гидроцефалией, благодаря участию в регуляции выживания и дифференцировки нейронов []. При данном заболевании происходит избыточное накопление жидкости, содержащейся в полостях головного мозга и спинномозговом канале. Гидроцефалия бывает врожденной и приобретенной. Возникает при нарушении всасывания, избыточного образования жидкости в полостях головного мозга и затруднении ее оттока, например, при опухолях, спайках после воспалительного процесса. Состояние проявляется признаками повышения внутричерепного давления: головной болью (в первую очередь), тошнотой, рвотой, нарушением различных функций: слуха, зрения (последние 3 признака могут отсутствовать). Также отмечается задержка в физическом развитии ребенка — позже начинают держать голову, садиться, ходить, наблюдается слабость конечностей, преимущественно ног, острота зрения снижается, нередки эпилептические припадки, дети отстают в умственном развитии. Во время заболевания  концентрация NGF в спинномозговой жидкости больных детей увеличивается, оказывая  существенное влияние на патогенез гидроцефалии [].

Современные знания о структуре и функциях фактора роста нервов можно использовать в качестве фундамента для разработки методов борьбы с болезнью Альцгеймера (БА) – это дегенеративное заболевание головного мозга, проявляющееся прогрессирующим снижением интеллекта. Причем, с течением времени человек утрачивает способность обслуживать себя. Впервые  болезнь описана немецким врачом А.Альцгеймером в 1907 году и, как на настоящее время стало ясно, является одной из наиболее распространенных форм приобретенного слабоумия (деменции). Только в США болезнью Альцгеймера, по данным 2007 года, страдают примерно 5 млн. человек и к 2050-му их число, по некоторым прогнозам, достигнет 13 млн. В американских домах престарелых 30% контингента составляют именно лица с БА. Хотя болезнь очень часто остается неопознанной, она занимает четвертое место среди причин смерти. В тех же США от нее, по оценочным данным, умирают более 100 тыс. человек в год. В патогенез БА вовлечено несколько различных механизмов, приводящих к утрате нервных клеток.  Поскольку впервые БА была описана у лиц моложе 65 лет, ее ранее именовали «пресенильной деменцией». И ошибочно рассматривали как «проявление старения» или «склероз мозговых сосудов». На самом деле, как сейчас  четко установлено, заболевание связано с дегенерацией нервных клеток (нейронов). БА примерно равномерно поражает все национальности и практически не зависит от социально-экономического статуса индивидуума. Со сложными болезнями, подобными БА, трудно бороться из-за того, что ни один из единичных подходов не адекватен. Исследуется сразу несколько нейропротективных подходов, и одним из перспективных в наше время является применение фактора роста нервов (NGF) – в норме присутствующего в организме белка, поддерживающего жизнеспособность нервных клеток головного мозга. В ряде исследований с инъекциями фактора роста нервов на ЦНС людей получены положительные результаты еще в 1980-е годы. С 1986 года доказан профилактический эффект инфузии NGF в головной мозг крыс в отношении гибели базальных холинергических нейронов переднего мозга на различных моделях (интоксикация, травмы и т.п.). С несомненным улучшением типичных когнитивных нарушений. Аналогичные дынные получены позже и для базальных отделов переднего мозга обезьян. Тем не менее, неспособность белка NGF пересечь гематоэнцефалический барьер, его короткий период полураспада и широкое влияние в пределах биологических сигналов делали невозможным их эффективное использование в клинических условиях. Кроме того, введение мышиного NGF пациентам с БА, боковым амиотрофическим склерозом и болезнью Паркинсона оказались неудачными из-за множества побочных эффектов. В ответ на эту дилемму были разработаны методики введения больным NGF-секретирующих клеток и в 2001 году начаты клинические испытания на человеке [] В настоящее время ученые большое количество времени уделяют направленному транспорту фактора роста нервов через гематоэнцефалический барьер в мозг с помощью нанотранспортных систем, а именно полимерных наночастиц  [].

Анализ литературы показывает, что помимо различных заболеваний фактор роста нервов участвует в таком необычном состоянии человека, как влюбленность. Установлено, что, впервые месяцы любовных отношений уровень NGF в организме человека выше, чем в последующее время.  Однако механизмы, лежащие в селективном увеличении NGF, еще не изучены, но предполагается, что увеличении концентрации фактора роста нервов происходит из-за эмоциональной зависимости или эйфории, а также стимуляции образования антидиуретического гормона (вазопрессина). Гормон гипоталамуса, который накапливается в задней доле гипофиза (в нейрогипофизе) и оттуда секретируется в кровь. Вазопрессин, а точнее его V(1A)-рецептор в мозге играет важную роль в социальном поведении, а именно в нахождении партнёра, в отцовском инстинкте у животных и отцовской любви у мужчин [].

4. Современные достижения в получении рекомбинантного NGF для фармацевтической  индустрии.

Из всего выше сказанного видно, что  рекомбинантный фактор роста нервов обладает огромным фармацевтическим потенциалом для терапии нейродегенеративных заболиваний центральной и периферической нервной систем, а также для ряда других патологических состояний, связанных с иммунной системой. Тем не менее, рекомбинантный NGF не является коммерчески доступным в качестве лекарственного средства. Существенным препятствием на пути создания лекарственных препаратов на основе NGF является труднодоступность данного белка. С одной стороны, эти белки практически невозможно выделить из природных источников. С другой стороны, биологически активный фактор роста нервов сложно получить в гетерологичных экспрессионных системах [].

На первых этапах для продукции NGF как правило, использовались эукариотические экспрессионные системы, которые характеризуются низким выходом целевого белка . Так в 1990 году  С. Сюдерстром с соавторами  встроили рекомбинантный NGF в  COS  клетки зеленой мартышки. При этом выход составил 1 мкг/мл [].  В 2000 году И. Шелли с соавторами описал получение рекомбинантного человеческого NGF используя клетки насекомых,  в качестве переносчика белка служил бакуловирус []. В 2007 году Муркин Е. В. получил линии мух D.melanogaster, содержащие ген красного флуоресцентного белка (DsRed) и ген фактора роста нервов (ngf) под контролем промотора белка теплового шока HSP70 D.melanogaster. Было показано, что при кокультивации со срезом мозга крыс клетки этих линий выживают и продуцируют трансгенный белок как минимум два дня. NGF, экспрессируемый клетками трансгенной линии D.melanogaster, кокультивированными со срезом мозга крыс усиливает рост и изменяет морфологию нейральной ткани (в том числе ускоряет образование связей между нервным клетками хозяина и кокультивированными клетками) [] В 2006 году была описана продукция rhNGF в Eisenia Foelida (WO/2006/082609 выделение человеческого NGF-подобного белка из Eisenia foelida и его использование). Данный метод очень сложный и труднореализуемый в промышленных масштабах, поскольку он требует выращивания Eisenia foelida (несколько особей), для этого необходима дорогостоящая система для выращивания и кольчатых червей, кроме того сам процесс подготовки кольчатых червей (прежде чем приступить к добыче рекомбинантного белка) трудоемкий и требует больших временных затрат. Кроме того при использовании животных для производства белка требуется строго соблюдать стерильность системы технического обслуживания, что не позволяет осуществлять непрерывное производство белка. Также RhNGF был получен в клетках насекомых (Barnettetal. J. Neuroehem. 57,1052-1061 1991, USPat. Номер 5272063) и в клетках млекопитающих (Iwane et al.Biochem, Biophys. Res Com/mm. 171,116-122, 1990; U.S.Pat. No. 5,639,664; Grey, Genetech U.S. Pat. No. 5,288,622) с лучшими результатами при получении in vitro биологически активных рекомбинантных белков.

Предложено несколько систем для производства NGF в растениях (описаны потенциально возможные системы, без каких-либо доказательств реальной продукции), эти системы предполагают использование генноинженерных семян однодольных растений, таких как рис, ячмень, пшеницы, сорго (US2004/0078851 Производство человеческого фактора роста в семенах однодольных растений). В 2011 году итальянскими учеными был предложена работа с использованием семян двудольных растений, таких как табак для экспрессии фактора роста нервов.

В последнее время все более популярные стали прокариотические экспрессионные системы, так как они являются экономически выгодными и позволяют получить больше белка. Анализ литературных источников показывает  различные способы получения значительного количества биологически активного рекомбинантного человеческого NGF (rhNGF) с использованием  клеток Escherichia coli.  Элени Дикоу в 1992 году описала метод, при котором в кишечной палочке NGF накапливался в виде телец включения. Дальнейший рефолдинг и очистка позволила получить около 7 мг/мл белка  95% чистоты, биологическая активность которого проверялась на культуре симпатических ганглиев 9 дневных куриных эмбрионов и оказалась в 50 раз меньше мышиной NGF, что может быть связанно с неправильным образованием дисульфидных связей внутри молекулы []. В 2011 году Л.М. Рафиева с соавторами осуществилf экспрессию proNGF в клетках Escherichia coli. BL-21 (DE3). При последуещем рефолдинге и очистке им удалось получить биологически активный биолог 80 % чистоты с конечной концентрцией 35-45 мкг/мл [].

5  Экспрессия рекомбинантных генов.

5.1 Вводная часть.

Основная цель экспериментаторов по клонированию генов, которые предполагается использовать в биотехнологии – подбор условий для эффективной экспрессии в нужном организме-хозяине. К сожалению, сам факт встраивания того или иного гена в клонируемый вектор, ещё не означает, что этот ген будет экспрессирован. В то же время, чтобы получение продукта было оправданным, уровень его синтеза должен быть достаточно высоким.

Для достижения эффективной экспрессии уже сконструировано много специальных векторов. Для этого проводились манипуляции с целым рядом генетических элементов. Среди молекулярно-биологических свойств систем экспрессии наиболее важны следующие: тип промотора и терминатора транскрипции; прочность связывания мРНК с рибосомой; эффективность трансляции в организме хозяина;  стабильность продукта в хозяйской клетке; конечная локализация синтезируемого продукта.()

Никакой универсальной стратегии оптимизации экспрессии клонированных генов не существует. Большинство генов имеют уникальные молекулярные свойства, и оптимальные системы экспрессии для каждого из них приходится подбирать всякий раз заново. Эффективность экспрессии любого чужеродного гена зависит также от его родства с организмом-хозяином. Несмотря на то, что многие представители как про- так эукариотических организмов способны к экспрессии чужеродных генов, для получения важных в коммерческом отношении продуктов с помощью технологии рекомбинантных ДНК используют в основном Escherichia coli. Это связано, прежде всего, с тем, что генетические, молекулярно-биологические, биохимические и физиологические свойства этого микроорганизма детально изучены. Кроме того, это наиболее дешевый и быстрый способ получения многих белков. ()

5.2  Конструирование экспрессионных векторов и их функционирование.

Экспрессия клонированных генов является одной из основных задач генной инженерии. Для получения полноценной экспрессии клонированных генов используют экспрессионные векторные системы, принципы конструирования которых, в настоящее время хорошо разработаны.

Экспрессия генетической информации, заключенной в генах живых организмов осуществляется путем ее переноса от нуклеиновых кислот к белкам по схеме: ДНК  РНК  белок. Любой полноценный в функциональном отношении ген состоит из двух основных частей – регуляторной и структурной. Генетический код, с помощью которого последовательность нуклеотидов в кодирующей структурной части гена определяет последовательность аминокислот в белке, универсален для всех живых организмов. Это дает возможность получения полноценной экспрессии самых разнообразных последовательностей нуклеотидов в любом природном генетическом окружении. Таким образом, универсальность генетического кода является основой для создания функционально активных генно-инженерных конструкций (33).

5.3 Факторы, оказывающие влияние на эффективность экспрессии рекомбинантных генов.

Для того чтобы в клетках E. coli произошла экспрессия клонированного гена, этот ген должен быть транскрибирован РНК-полимеразой, а образовавшаяся РНК транслирована рибосомами с образованием нативного белкового продукта.  Для эффективной экспрессии  в клетках E. сoli ген должен находиться под контролем регуляторных элементов  данного микроорганизма. Регуляторная часть генов распознается соответствующими ферментными системами организма и обеспечивает упорядоченную экспрессию его структурной части.  Основным регуляторных элементов является промотор ().

Экспрессия генов при участии сильных регулируемых промоторов.

Для эффективной экспрессии любого гена  необходимо наличие сильного регулируемого промотора, расположенного перед данным геном. Такой промотор имеет высокое сродство к РНК-полимеразе, поэтому прилегающие к нему последовательности эффективно (с высокой частотой) транскрибируются. Регулируемость промотора позволяет осуществлять строгий контроль транскрипции.

Необходимость регулирования экспрессии генов в генной инженерии диктуется, прежде всего, тем, что сверхэкспрессия рекомбинантных белков может отрицательно сказываться на жизнеспособности клеток-продуцентов,  поскольку она приводит к истощению энергетических ресурсов клетки и нарушению её метаболизма. Кроме того, продукты экспрессии часто обладают цитотоксическим действием. В этом случае  может сильно снижаться скорость роста  культуры. Для предотвращения такого рода эффектов используют конструкции, в которых экспрессия клонированных генов подавлена (репрессирована) на ранних фазах роста клеток и может быть дерепрессирована в любой нужный момент времени.

Наиболее широко используются следующие сильные регулируемые промоторы: промоторы lac- и trp-оперонов Е. coli; специально сконструированный tac-промотор, включающий —10-область lac-промотора и —35-область trp-промотора (участки, находящиеся на расстоянии 10 и 35 п. н. до сайта инициации транскрипции); левый, или pL, промотор бактериофага λ; промотор гена 10 бактериофага Т7. С каждым из них связываются соответствующие репрессоры, которые опосредуют включение и выключение транскрипции специфических генов ().

Часто для контроля экспрессии клонированных генов используют систему регуляторных элементов лактозного оперона (lac-оперона).  В векторную молекулу вводят регуляторную последовательность lac-оперона, за которой следуют последовательности нуклеотидов полилинкера с несколькими уникальными сайтами рестрикции, по которым проводится клонирование исследуемого гена. Одновременно в тот же вектор вводится ген-регулятор, кодирующий белок-репрессор. В отсутствие индуцирующего воздействия молекулы репрессора, ген которого экспрессируется конститутивно, связываются с оператором, тем самым, препятствуя взаимодействию РНК-полимеразы с промотором. Это приводит к резкому снижению уровня транскрипции клонированного гена. Для индукции lac-оперона используют синтетический аналог природного индуктора (алло-лактозы) – изопропил–-D-тиогалактопиранозид (IPTG). Индуктор связывается с молекулой репрессора и нарушает его взаимодействие с операторным участком ДНК. Область lac-промотора становится доступной для РНК-полимеразы, которая с высокой эффективностью начинает транскрибировать гены, расположенные вслед за промотором (33).

Промотор trp выключается под действием комплекса триптофан—trp-репрессор, который связывается с trp-оператором и предотвращает транскрипцию trp-оперона. Активация (включение) trp-промотора происходит либо при удалении из среды триптофана, либо при добавлении 3-индолилакриловой кислоты.

Работа промотора pL регулируется репрессорным белком сI бактериофага λ. На самом деле для регуляции транскрипции с pL-промотора обычно используется термочувствительная мутантная форма репрессора сI — белок cI857. Клетки, синтезирующие этот репрессор, сначала выращивают при температуре 28—30 °С. В этих условиях репрессор блокирует транскрипцию с pL-промотора. Когда культура достигает нужной фазы (как правило, середины log-фазы), температуру повышают до 42°С, при которой cI857-репрессор инактивируется и начинается транскрипция.

Для транскрипции с промотора бактериофага Т7 нужна соответствующая РНК-полимераза. Чтобы можно было использовать этот промотор, ген РНК-полимеразы фага Т7 встраивают в хромосому Е. coli в составе профага λ, поместив его под контроль lac-промотора. Затем клетки трансформируют плазмидой, содержащей ген под контролем Т7-промотора, и добавляют в среду ИПТГ. В этих условиях происходит индукция гена РНК-полимеразы Т7, синтезируется РНК-полимераза и происходят транскрипция и трансляция клонированного гена. Часто между временем индукции гена РНК-полимеразы Т7 и началом транскрипции гена проходит более часа. Для транскрипции с сильного Т7-промотора создана целая серия плазмид, получивших название рЕТ-векторов ().

При культивировании в небольших объемах (от 1 до 5л) индукцию экспрессии осуществляют либо изменением температуры, либо добавлен ием химического индуктора. Однако в опытных установках (20—100 л) и в промышленных биореакторах (>200 л) температуру нельзя изменить мгновенно, для этого требуется время от 30 до 60 мин,  кроме того, на подъем температуры нужна энергия. Поэтому обычно применяют химический индуктор, например ИПТГ.

Трансляция генов.

Наличие сильного регулируемого промотора – это важное, но недостаточное условие суперэкспрессии белков. Эффективность экспрессии рекомбинантных генов не в меньшей степени зависит и от эффективности трансляции мРНК рибосомами. Чаще всего приходится иметь дело с системами, в которых экспрессируемые ДНК чужеродны по отношению к генетическому окружению и ферментативным системам бактериальных клеток-хозяев.

Различия в трансляции связаны со свойствами имеющегося в транскрибированной РНК сигнала инициации трансляции, называемого сайтом связывания рибосомы. Сайт связывания рибосомы — это последовательность из шести-восьми нуклеотидов (например, UAAGGAGG), спаривающаяся с комплементарной последовательностью (в данном случае AUUCCUCC) малой субъединицы рибосомальная РНК (рРНК). Обычно чем прочнее связывание между мРНК и рРНК, тем выше эффективность инициации трансляции. Именно поэтому большинство экспрессионных векторов конструируют таким образом, чтобы мРНК клонированного гена обязательно содержала сильный сайт связывания рибосомы. Это необходимое условие трансляции гетерологичных про- и эукариотических генов в Е. coli. Однако должны соблюдаться и некоторые другие условия. Во-первых, нуклеотидная последовательность, связывающаяся с рРНК, должна находиться на определенном расстоянии от старт-кодона клонированного гена (в РНК старт-кодоном является AUG, в ДНК ему соответствует кодон ATG). Во-вторых, участок ДНК, содержащий сайт связывания рибосомы и несколько первых кодонов клонированного гена, не должен иметь такую нуклеотидную последовательность, при которой после транскрипции может произойти внутрицепочечное спаривание, нарушающее связывание мРНК с рибосомой. Именно локальная вторичная структура мРНК, обеспечивающая экранирование или, напротив, экспонирование сайта связывания рибосомы, и определяет прочность связывания мРНК с комплементарной рРНК. Таким образом, при клонировании любого гена важно убедиться в том, что сайт связывания рибосомы расположен на нужном расстоянии от этого гена и что вторичная структура мРНК не помешает его присоединению к рибосоме.

Из всего вышеизложенного следует, что некодирующая часть мРНК играет важную роль в эффективности ее трансляции рибосомами, и эти особенности их трансляции необходимо учитывать при конструировании векторов для экспрессии рекомбинантных генов в клетках E. coli. Современные экспрессионные вектора построены таким образом, что промотор, а также следующая за ним последовательность нуклеотидов, включающая инициирующий ATG-кодон, являются частью генов, эффективно экспрессирующихся в клетках E. coli. Сразу вслед за ATG-кодоном вектора располагают уникальные сайты рестрикции, по которым проводят встраивание кодирующей части гена, экспрессию которого хотят получить ().

Стабилизация белков.

Следующим важным фактором, определяющим уровень экспрессии рекомбинантных генов, является стабильность кодируемых этими генами белков. Обычно время полужизни белков составляет от нескольких минут до нескольких часов. Такая вариабельность обусловливается различиями в числе дисульфидных связей в белковых молекулах и наличием или отсутствием на 5'-конце определенных аминокислот. Например, если к N-концу  β-галактозидазы присоединять разные аминокислоты, то время жизни модифицированного белка in vitro может варьировать от двух минут до более 20 часов. Аминокислоты, увеличивающие время жизни белков, можно включать в белки генноинженерными методами. Часто для стабилизации белка-мишени достаточно присоединить к N-концу всего один аминокислотный остаток. Долгоживущие белки накапливаются в клетках, что увеличивает конечный выход продукта ().

Локализация рекомбинантных белков в клетке.

Экспрессия эукариотических генов в бактериальных клетках связана с проблемой, что большая часть рекомбинантных эукариотических белков при очень высоком уровне биосинтеза переходят в нерастворимое состояние, образуя в клетках так называемые тельца включения. Тельца включения представляют собой частицы, состоящие главным образом из агрегатов рекомбинантного белка и ряда бактериальных белков. Рекомбинантные белки в тельцах включения находятся, как правило, в денатурированном неактивном состоянии, и для их получения в растворимом виде приходится применять мощные денатурирующие агенты, такие как мочевина, гуанидинхлорид и детергенты. Солюбилизированный в этих жестких условиях рекомбинантный белок для восстановления нативной конформации требует ренатурации. В процессе обработки денатурирующими агентами белки могут изменять свою структуру, а при концентрировании из разбавленных растворов, в которых проводится ренатурация, часто вновь выпадают в осадок. Один из подходов, позволяющий повысить растворимость белка внутри клетки, это экспрессировать его в составе гибридного полипептида, другой компонент которого сам по себе обладает высокой растворимостью. Известно, что гибридные белки, одним из компонентов которых является тиоредоксин, белок с молекулярной массой 11,7 кД, остаются в растворе, даже если на их долю приходится 40% суммарного клеточного белка. Далее белок-мишень можно отщепить от гибридного белка с помощью энтерокиназы ().

В связи с вышеупомянутыми трудностями выделения белка из ТВ, получение целевого продукта в растворимой форме может существенно упростить схему очистки и тем самым снизить себестоимость конечного препарата. В настоящее время не существует универсального метода, который бы позволял получать рекомбинантные эукариотические белки в бактериальных клетках в нативном виде. В некоторых случаях понижение температуры выращивания бактерий приводит к образованию полностью растворимых рекомбинантных белков. Универсальным подходом для получения белков в растворимой форме является обеспечение секреции их в культуральную жидкость. Системы секреции у грамположительных и грамотрицательных бактерий интенсивно изучаются. Выход рекомбинантных белков в культуральную жидкость значительно облегчает их очистку, так как не требуется стадия дезинтеграции клеток и, следовательно, нет загрязнения целевого белка ДНК и белками Е. coli.  Кроме того, у секретируемых белков больше шансов приобрести нативную конформацию, так как сворачивание полипептидных цепей происходит в большом объеме, а, следовательно, и в более низкой их концентрации, что предотвращает агрегацию полипептидных цепей, не полностью сформировавших свою третичную структуру. Однако при использовании секреционных конструкций, выход целевого белка значительно меньше (на порядок и более), чем при использовании конструкций, позволяющих нарабатывать белок внутри клетки – в тельцах включения или в растворимом виде [].

Образование нерастворимых телец включения в бактериальных клетках в ряде случаев является преимуществом, а не недостатком, поскольку тельца могут облегчать очистку рекомбинантных белков и защищать их от протеолитической деградации.

Системы экспрессии весьма разнообразны, и часто приходится каждый раз подбирать условия, наиболее подходящие для получения того или иного белка. И всё же, несмотря на различие в деталях, для создания самых разнообразных систем экспрессии используются одни и те же основные приёмы.

6 Выводы по разделу

Фактор роста нервов (англ. nerve growth factor, NGF) один из нейротрофинов,  кодируемый у человека геном NGF на коротком плече 1-й хромосоме. Представляет собой небольшой секретируемый белок, определяющий развитие симпатической нервной системы, благодаря стимуляции нервных клеток.

Современные знания  о данном белке позволяет его использовать при коррекции и лечение заболеваний центральной нервной системы, связанных с психическими расстройствами (слабоумие, депрессия, шизофрения, аутизм, синдром Ретта, анорексии и булимии, болезни  Альцгеймера). Кроме того он играет важную роль в сердечно – сосудистых заболеваниях (атеросклероз коронарных артерий, ожирение, сахарный диабет 2 типа). Существует доказательство того, что NGF может быть полезен в лечении кожных язв и язв роговицы.

Все выше сказанное говорит о том, что создание лекарственных препаратов на основе фактора роста нервов является социально значимой проблемой. Данный белок практически невозможно выделить из природных источников. Поэтому  перспективным является  получение биологически активного фактора роста нервов в гетерологичных экспрессионных системах. Анализ литературы по данной проблеме показывает небольшое количество информации, что говорит об актуальности и перспективе получения рекомбинантного NGF

 

Основная часть

1. Материалы, методы и оборудование

1.1 Оборудование

Автоматические PCR-амплификатор Eppendorf Mastercycler personal (Германия); центрифуги Eppendorf Cenrifuge 5415C (Германия), Eppendorf Mini Spin (Германия), Jouan CR34 (Франция); ультрацентрифуга Beckman Coulter Optima L-100K (США); ультразвук MSE Soniprep 150 (Великобритания); качалки ELM Sky Line (Латвия); холодильные и морозильные камеры Bosch, Stinol (Беларусь), Atlant (Россия); кельвинатор New Brunswick Ultra Low Tempreture Freezer U 570 (США);pH-метр 440 (Аквилон, Россия); источник тока: Эльф-4 (ДНК-Технология, Россия), горизонтальная камера для электрофореза нуклеиновых кислот Helicon SE-1, (Россия); мешалки Hiedolph  MR 3000, MR 3001 (c подогревом) (Германия); автоматические пипетки Gilson (Франция); электронные весы Sartorius laboratory L 610 (Германия); торсионные весы Techniprot (Польша); термостат СПУ ТС-1/20 (Россия); ламинар Gelaire Flow Laboratories Twin 30 (Италия); спектрофотометр Varian Cary 50S Scan (Австралия); водный  термостат MLW UH 4 (Германия); установки для очистки воды Milli-Q EASYpureII (UV/UF ultra purewater system), REVERSINO (Werner, Германия), напольный инкубатор-шейкер CERTOMAT® BS1 (Sartoriuslaboratory, Германия), инкубатор-шейкер INNOVA® 44 (New Brunswick Scientific, США); вакуумный насос ASHCROFT (Millipore, США); набор автоматических пипеток Pipetman® P20, P100, P200, P1000 (Gilson, США); вортекс VD-6 (SkyLine ELMI, Латвия), REAX (Hiedolph, Германия), фотоаппарат PowerShot G6 (Canon, Япония),автоклав Sanyo Labo AutoclaveMLS –3751L (Япония); электронный дозатор Bio Hit Midi Plus (Финляндия); хроматограф  AKTA purifier (Швеция);установка для dot-blot метода DOT®Apparatus (BIO-RAD, США).

1.2 Программное обеспечение

Операционная система Windows 7, текстовый редактор Word Pad, Microsoft Office Word 2007, Microsoft Office Excel 2007, Microsoft Office Power Point 2007.Clone Manager, DNABuilder,  Сhromas, ChemSketch, Swiss-Pdb Viewer, Ras Mol.

1.3 Лабораторные посуда и расходные материалы.

Стаканы, цилиндры, конические колбы фирм Simax (Чехия), Schott Duran (Германия); системы для фильтрования и дегазирования растворов фирмы Millipore (США); кварцевые кюветы фирмы Carl Roth (Германия); мембраны из нитроцеллюлозы для dot-blot метода HVLP фирмы Millipore (США); шприцевые насадки для фильтрования Millex® GV, PVDF и 0.22 m и 0.1 m фирмы Millipore (США);системы для фильтрованияStericup® GP Express Plus объемом 250 мл, 500 мл фирмы Millipore (США).

Полипропиленовые пробирки емкостью 0.25, 0.6, 1.7 и 2.0 мл фирм Corning (США); наконечники для автоматических пипеток фирм Quantum Scientific Pty Ltd. (Австралия), Corning (США), Thermo Lab (США), Treff (Германия); полипропиленовые пробирки емкостью 15 и 50 мл фирмы Corning (США); полипропиленовые пробирки емкостью 50 мл фирмы Labcon (США); чашки с крышкой Петри фирм GreinerBio-One (Германия), Биомедикал (Россия); лабораторная пленка Parafilm® M (American National Can, США).

Латексные перчатки фирм Carl Roth (Германия) и Kimberly Clark Professional (США).

1.4 Штаммы E.coli

XL1-Blue (“Stratogene”): F’::Tn10(Tetr), proA+B+, lacIQ, endA1, gyrA96, (lacZ)M15/recA1, , thi, hsdR17, (rk¯mk+ ), supE44, relA1, lac;

BL21(DE3): E. coliB, F¯, ompT, hsdSB (rB¯mB¯), gal, dcm (DE3); этот штамм, не содержащий  протеиназ Lon, OmpT и Dcm метилазы обычно используется для экспрессии генов;

1.5 Среды для выращивания бактерий

YT: 8 г/л бакто-триптона, 5 г/л дрожжевого экстракта, 5 г/л NaCl;

TB: 1,2% бакто-триптона, 2,4% дрожжевого экстракта, 4% глицерина, 17 мМ KH2PO4, 72 мМ К2НРО4;

TB – 5052: На 50 мл: 20 x P, 100 мкл. 1M MgSO4, 10 мкл. 1000 x Trace,

1 мл. 50 x 5052, 100 мкл. ампициллина, 46 мл. TB (без фосфатов).

2ZY: 2% триптона, 1% дрожжевого экстракта;

ZYM-5052: 1% N-Zамин, 0.5% дрожжевого экстракта, 25 mMNa2HPO4, 25 mMKH2PO4,50 mM NH4C1, 5 mMNa2SO4, 2 mMMgSO4, 0.2 XTrace, 0.5 % глицерола, 0.05% глюкозы, 0.2 лактозы.

YT-агар: 1,5% агар на YT.

Во все среды перед использованием добавлялись соответствующие антибиотики. Рабочая концентрация ампецилина –50-125 мкг/мл.

1.6  Препараты ДНК

Коммерческие плазмиды pET32a (Novagen, США); pGEMEX1 (Promega, США).

Синтетические олигонуклеотиды для сборки гена NGF были синтезированы ЗАО «Евроген», Россия.

NGF1: GGAATTCCATATGTCTTCTTCTCAT

NGF2: TCACAAACGGAAAATTCACCACGATGAAAAATTGGATGAGAAGAAGACAT

NGF3: ATTTTCCGTTTGTGACAGCGTTTCTGTTTGGGTTGGCGACAAAACGACTG

NGF4: CAGAACCATCACCTCTTTGCCCTTGATGTCGGTCGCAGTCGTTTTGTCGC

NGF5: GAGGTGATGGTTCTGGGTGAAGTAAACATTAACAACTCCGTCTTCAAACA

NGF6: GATTCGGATCACGACATTTAGTTTCGAAGAAGTACTGTTTGAAGACGGAG

NGF7: GTCGTGATCCGAATCCGGTGGACTCCGGTTGCCGTGGTATCGATTCTAAA

NGF8: AAGGTATGAGTGGTGGTGCAATAGCTGTTCCAGTGTTTAGAATCGATACC

NGF9: CACCACTCATACCTTCGTGAAAGCGCTGACCATGGATGGTAAACAGGCAG

NGF10: CACGCAAGCGGTATCGATGCGGATGAAGCGCCATGCTGCCTGTTTACCAT

NGF11: GATACCGCTTGCGTGTGCGTACTGAGCCGTAAGGCCGTACGTCGCGCTTA

NGF12: CCGCTCGAGTTAAGCGCGACGTACG

1.7 Ферменты

В работе были использованы эндонуклеазы рестрикции фирм New England Biolabs (США), Fermentas (Литва); ДНК-лигаза фага Т4 Fermentas (Литва); термостабильная PfuI ДНК-полимераза (Promega, США); термостабильная KAPA2G-HiFi ДНК-полимераза (Kapa biosystems, США).

1.7 Реактивы и наборы реактивов

Для приготовления питательных сред были использованы: бакто – триптон, дрожжевой экстракт,  глицерин,  глюкоза,  лактоза (Panreac Испания). Антибиотики: ампецилин и хлорамфеникол (GmbH ,Германия). Реактивы для приготовления буферов: дигидрофосфат калия (натрия), гидрофосфатдикалия (динатрия), хлорид натрия (калия), трис-HCl, SDS, Triton X-100 производства фирмы Panreac (Испания); ЭДТА, β-меркаптоэтанол, DTT, HEPES производства фирмы Sigma-Aldrich (Германия). Реактивы для электорофоретического разделения ДНК агароза, бромистый этидий фирмы Helicon (Россия), борная кислота (Россия),  ДНК маркер SM 1331 Fermentas(Литва);. Реактивы для иммунодот-блота наборы антител против гистидинового тага, против константной части антител гистидинового тага с щелочной фосфатазой, субстратами NTB, BCIP-T производства Sigma (Германия), Твин 20 фирмы Panreac (Испания). Прочие: DMSO, ацетат натрия производства Panreac (Испания); PMSF, биотин производства Appli Chem (Германия); изопропанол-2, этанол, хлороформ, фенол фирмы Merck (Германия).

Набор реактивов для выделения и очистки ДНК: QIAprep Spin Miniprep Kit (QIAGEN, Германия), GelElutePlasmid Miniprep Kit (Sigma, США).

1.8 Растворы и буферы.

Буфер для электрофоретического разделения нуклеиновых кислот:

развести в 20 раз водой ТВЕ. Добавить 50 мкл на литр этидий бромида.

Краска для нанесения в агарозный гель:

2,7 мл (3,4 г) глицерина, 0,3 мл 10  ТВЕ буфер, 100 мкл 10% SDS, 1 мл 0,5 М ЕДТА, 0,9 мл воды, 1 мг бромфенолового голубого.

Приготовление маркера для электрофореза:

смешать 100 мкл краски для нанесения в агарозный гель, 100 мкл маркера λ/HindIII фрагментов ДНК и 400 мкл воды.

Приготовление смеси фенол-хлороформ:

отфасовать в сцинтилляционный флакон равные объемы хлороформа и нейтрализованного фенола; поместить туда же небольшое количество верхней водной фазы от нейтрализованного фенола;

Приготовление 100 мМ раствора PMSF:

растворить PMSF в изопропаноле в концентрации 17.4 мг/мл. Хранить раствор при -20°С.

Трис-боратный буфер (х10), рН 8.8 (ТВЕ):

смешать 108 г Трис, 55 г борной кислоты, 9.3 г ЕДТА. Долить воды до 1 л (рН 8.3-8.6 подводить не нужно). Профильтровать через фильтр 0.62 микрона.

Трис-ацетатный буфер (х50) (ТАЕ):

смешать 242 г Трис, 57 мл уксусной кислоты и 100 мл 0.5 М ЕДТА, рН 8.0. Довести объем до 1 л водой.

Приготовление РВS буфера (х10):

растворить 80 гNaCl, 2 гKCl, 14.4 г Na2HPO4, 2.4 г KH2PO4 в 800 мл воды. Довести рН до 7.4 концентрированной HCl. Довести объем до 1 л.

TES-буфер:

10 мМ Трис, рН 6.8, 1 мМ ЕДТА, 2 % SDS.

70% спирт:

79,2 мл (63.33 г) 96% этанола смешать с 23,33 мл воды MilliQ

1 М Трис-HCl:

растворить 121 г Трис (основание) в 800 мл воды. Подвести до необходимого рН концентрированной соляной кислотой. Довести объем до 1 л водой. Профильтровать через мембрану с диаметром пор 0.2-0.45 микрона.

5 М NaCl:

растворить 292 г NaCl в 1 л воды. Профильтровать через мембрану с диаметром пор 0.2-0.45 микрона.

5 М NaОН:

растворить 400 г NaOH в 1 л воды.

Буфер для фракционирования белков:

Тритона X-100 0.1%, PMSF 0.1 мМ , EDTA 1 мМ

Cтоковые растворы для приготовления электрофорезного геля:

Раствор акриламида 30%, 29:1, 1М Трис-HCl, pH 8.8, 1М Трис-HCl, pH 6.8, 10% SDS, 10% раствор APS

Электродный буфер:

0.025М Tris-HCl, 0.192 М Глицин, 0.1% SDS, pH 8.3

2х-кратная краска для нанесения на белковыйфорез:

0.125 М Tрис-HCl pH 6.8, 4% SDS, 20% v/v глицерин, 10% 2-меркаптоэтанол, 0.02% бромфеноловый синий, pH 6.8

Фиксирующий раствор:

10% уксусная кислота

Окрашивающий раствор:

10% уксусная кислота, 0,006% Coomassie G-250 Brilliant Blue.

Буфера для очистки гибридного белка методом МХАХ на HisTrap HP:

Буфера для очистки 20-кД ГР методом анионообменной хроматографии:

1.9 Методы исследований

1.9.1 Рестрикция

Рестрикцию проводили из расчета 20 ед. фермента на 1 мкг плазмидной ДНК. Общий объем реакционной смеси определялся количеством расщепляемой ДНК и концентрацией используемых ферментов. Буферы для эндонуклеаз рестрикции подбирались согласно рекомендациям производителей. Рестрикционную смесь (плазмидная ДНК, ферменты, буферы для ферментов, вода) инкубировали в течение 2 часов при 370 С.

1.9.2 Электрофоретичское разделение ДНК в агарозном геле.

Для разделения фрагментов ДНК или плазмидной ДНК использовали 1,5 – 2% агарозный гель, приготовленный на трис-боратном буфере (TBE) с 0.5 мкг/мл бромистого этидия. Электрофорез проводили в буфере TBE при напряженности электрического поля 6 В/см. По окончании электрофореза гель просматривали в ультрафиолетовом свете на трансиллюминаторе ATM (Bio Tech Med Aps, Дания).

1.9.3 Выделение ДНК из агарозного геля.

При ультрафиолетовом освещении из агарозного геля скальпелем вырезали полосу, соответствующую нужному фрагменту ДНК, и затем очищали от агарозы при помощи набора MiniSpin Elute Gel Extraction Kit (QIAGEN) согласно инструкциям изготовителя.

1.9.4. Полимеразная цепная реакция (ПЦР).

ПЦР при помощи KAPA2G ДНК полимеразы.

Реакционная смесь на 25 мкл.содержала 25 нг. матричной ДНК,  0.2 mMdNTP, по 0.50 микромоль олигонуклеотидных праймеров  и 0.5 едениц термостабильной KAPA2G ДНК полимеразы в 5 мкл. 5X KAPA 2G BufferA. Проводили 20-30 циклов реакции амплификации по следующей схеме: плавление ДНК при 95оС в течение 15 секунд, отжиг1праймеров в течение 15 секунд, и элонгация цепи при 72оС в течение 30 секунд2. В конце проводили завершающую элонгацию в течение 3 минут. По завершении реакции наличие нужного продукта проверяли электрофорезом в агарозном геле.

ПЦР при помощи PfuI ДНК-полимеразы

Реакционная смесь содержала 50 нг матричной ДНК, по 2 пмоль олигонуклеотидных праймеров, по 2,5 мМ каждого из четырех dNTP и 1-2.5 ед. термостабильной Pfu ДНК-полимеразы в 50 мкл реакционного буфера: 20 мМTris-HCl (pH 8.8 при 25С), 10 мМ (NH4)2SO4, 10 мМKCl, 0.1% тритона X-100, 0.1 мг/мл БСА. Проводили 20-30 циклов реакции амплификации по следующей схеме: плавление ДНК при 96С в течение 30 секунд, отжиг праймеров в течение 30 секунд, и элонгация цепи при 74С в течение 1 минуты. В конце проводили завершающую элонгацию в течение 5 минут. По завершении реакции наличие нужного продукта проверяли электрофорезом в агарозном геле.

1.9.5 Лигирование.

Реакцию лигирования проводили, используя ДНК лигазу фага Т4, согласно рекомендациям фирмы-изготовителя фермента. В качестве контроля использовали реакционную смесь без фрагмента.

1.9.6 PIPES трансформация клеток E. coli плазмидной ДНК

Компетентные клетки, хранившиеся при -70С, размораживали во льду 10 минут, затем добавляли холодный раствор ДНК (~10 нг в объеме 1-5 мкл) и инкубировали во льду в течение 30 минут, периодически встряхивая. Далее проводили «heat shock»: пробирку с клетками инкубировали 30 секунд на водяной бане при температуре 420 С и затем помещали на 5 минут в лёд. В стерильных условиях добавляли 900 мкл среды YT, инкубировали при 370 С в термостате с умеренным перемешиванием (250 об/мин) 1 час и рассевали на чашки с YT -агаром, содержащим ампициллин. Выращивание проводили в течение ночи при 37С.

1.9.7 Культивирование, выделение и очистка плазмидной ДНК из клеток E. coli

Плазмидную ДНК поддерживали в штамме XL1-Blue. С селективных сред на чашках Петри с трансформированными клетками снимали в стерильных условиях 1 колонию и помещали ее в пробирку (15 мл) со средой YT (3 мл), содержащую ампициллин. Клетки культивировали в течение ночи при 37С в термостате с умеренным перемешиванием (250 об/мин). Выделение и очистку плазмидной ДНК проводили с использованием наборов реактивов фирм QIAGEN (Германия). Все манипуляции осуществляли согласно протоколу фирмы изготовителя. Выход ДНК с 3 мл ночной культуры составлял примерно 20 мкг.

1.9.8  Проведение ПЦР-скрининга.

Готовили 20 мл реакционной смеси, содержащей 1 ед. Taq-полимеразы, 1х буфер для Taq-полимеразы, 0,2 мМ нуклеозидтрифосфаты (dNTPs), 1 мкМ каждого из праймеров. Пластиковым наконечником собирали часть колонии, которая нуждалась в проверке, и суспендировали в реакционной смеси. Дальше проводили ПЦР на приборе «Mastercycler personal» («Eppendorf», Германия) по следующей схеме: предварительный цикл прогрева в течение 5 минут при 96°С и  циклов амплификации 30. Один цикл амплификации включал в себя денатурацию ДНК при 95ºС (30 сек), отжиг (30 сек) и элонгацию при 74ºС. Результаты фиксировались электрофорезом в агарозном геле.

1.9.9 Секвенированиеплазмидной  ДНК.

Секвенирование ДНК проводили в Межинститутском Центре коллективного пользования “ГЕНОМ” Центр “Биоинженерия” РАН, с помощью набора реактивов ABI PRISM® BigDye™ Terminator v. 3.1 с последующим анализом продуктов реакции на автоматическом секвенаторе ДНК ABI PRISM 3100-Avant (Applied Biosystems, США).

1.9.10 Быстрая трансформация.

Готовили ночную культуру штамма, который необходимо трансформировать. Использовали для этого пробирку на 15 мл. Объем культуры –  не более 3 мл, среда - YT. Выращивали на качалке при 250 об/мин и 37°С 16 часов. К 3 мл свежей YT среды в пробирке на 15 мл добавляли  30 мкл ночной культуры и выращивали на качалке при 37°С и 250 об/мин  в течение 2-3 часов до достижения плотности культуры 0.6 – 0.9 о.е. при 550 нм. Переносили 1 мл культуры в стерильную пробирку Eppendorf. Центрифугировали при 12.000 g в течение 1 мин. Супернатант сливали. Центрифугировали пробирку при 12.000 g в течение 15 сек. Тщательно удаляли остаток супернатанта. К клеточному осадку добавляли 100 мкл раствора для трансформации и суспендировали. Затем инкубировали во льду 5 мин. Добавляли раствор плазмидной ДНК (~10 нг в объеме 1-5 мкл) и инкубировали во льду в течение 8 мин. Далее проводили heatshock: пробирку с клетками инкубировали 30 секунд в термостате при температуре 42С и затем помещали на 2 минуты в лёд. После добавляли 900 мкл среды YT и инкубировали при 37С в термостате с перемешиванием (550 об/мин) 1 час. После высевали 50 мкл суспензии на чашки с агаризованной средой и антибиотиком. Концентрации антибиотика: ампициллин – 50 мг/л. Инкубировали при 37°C в течение ночи.

1.9.11 Анализ экспрессии целевого гена.

Для выращивания бактерий использовали автоиндукционную среду 2ZYM – 5052 и среду TB - 5052 . В среды добавляли антибиотик в концентрации 100 мкг/мл и помещали в колбы из расчета 10 мл среды на 100 мл колбу. Среды заражали колониями, собранными с чашек, содержащих YT-агар с антибиотиками, из расчета 3 колонии на 1 мл питательной среды.  Далее колбы инкубировали при 37ºС , перемешивая (300 об/мин) в течение 24 часов.

1.9.12 Выделение суммарного (общего) белка из клеток E. сoli.

 Центрифугировали 100 мкл культуральной среды при 12.000 g в течение 10 мин. Осадок суспендировали в 100 мкл ТES-буфера. Нагреванием при 95°С в течение 5 мин лизировали клетки. Нерастворимые частицы осаждали центрифугированием в течение 5 мин при 12.000 g. Отобрали супернатант и смешали в равном соотношении с краской для белкового электрофореза.

1.9.14 Фракционирование белков из клеток E. сoli.

Биомассу, собранную с 0,5 мл культуры, размораживали и суспендировали в 50 мкл сферопластного буфера. К суспензии добавляли 5 мкл лизоцима (4 мг/ мл), приготовленного на сферопластном буфере, перемешивали и инкубировали при комнатной температуре в течение 30 минут (периодически перемешивая). По окончании времени инкубации добавляли 450 мкл 0.1% Тритона Х-100, содержащего 0.1 мМ PMSF и 1 мМ ЭДТА, и инкубировали при комнатной температуре еще 5 минут. Образец обрабатывали ультразвуком на максимуме в течение 30 – 40 секунд, центрифугировали в течение 10 минут при 12000 g. Супернатант (это растворимый белок) отбирали в отдельную пробирку. Для получения раствора белка из телец включения осадок растворяли в 500 мкл TES-буфера.

1.9.15 Денатурирующий белковый электрофорез в SDS-ПААГ.

Белковый электрофорез (ЭФ) проводили по методу Лэммли (Laemmli). Применяли 14 % разделяющий и 10 % формирующий гели,. Перед нанесением на гель образцы смешивали с буфером для нанесения. Электрофорез проводили при постоянном напряжении  200 В на приборе Mini–Protean II (“Bio–Rad”, США). После проведения электрофореза гель фиксировали и отмывали от SDS в растворе 10% уксусной кислоты в течение 30 минут. Затем гель окрашивали в растворе следующего состава: 10% уксусной кислоты, 0.1% Кумасси R–250 в течение 1 мин. Отмывку геля от краски проводили в растворе 10 % уксусной кислоты.

1.9.16 Отмывка телец включения

Замороженные клетки с 100 мл богатой среды 2 ZYM – 5052 суспендировали в 25 мл  охлажденного лизис буфера ( 50 мМ Tris pH 8.0  и 0.1 % Triton). Суспензию обработали ультразвуком 5 раз по 30 сек. с охлаждением в перерывах 2 мин. Центрифугировали  при 13400g, 40С, 10 минут. Для отмывки  от тритона осадок суспендировали  в 10 мл буфера (50 мМ Tris pH 8.0 и 100 мМ NaCI) и обработали ультразвкуом 5 раз по 30 секунд с охлаждением в перерывах 2 мин. Центрифугировали  при 13400g, 40С, 10 минут. и повторили процедуру.

1.9.17 Растворение телец включения

Отмытые тельца включения растворяли в буферах, указанных в таблице _ , в течение 1 часа при комнатной температуре и постоянном перемешивании. Нерастворимую часть отделяли при помощи центрифугирования при 13400g (4С) в течение 20 минут. Осадок и супернатант анализировали при помощи денатурирующего ПААГ-электрофореза по Лэммли.

Таблица _ - Буфера для растворения телец включения.

Состав буфера

1

50 мM Tris-HCl, pH 8.0, 0.1 M NaCI

2

50 мM Tris-HCl, pH 8.0, 0.1 M NaCI, 0,5% Triton X-100

3

50 мM Tris-HCl, pH 8.0, 0.1 M NaCI, 5 М мочевины

4

50 мM Tris-HCl, pH 8.0, 0.1 M NaCI, 3.5 М гуанидин гидрохлорида

1.9.18 Выделение SumoNGF при помощи металло-хелат-аффинной хроматографии

Образец растворенного гибридного белка, выделенный из 100 мл культуры, суспендировали в 4 мл буфера А, после чего смешивали с 800 мкл Ni2+-металлохелатной аффинной смолы, уравновешенной тем же буфером А и инкубировали в течение 1 часа при перемешивании. Смолу промывали сначала 5 мл буфера А, а потом 5 мл буфера В (буфер А с 150 мМ имидазола). Элюцию проводили 4 мл буфера С (буфер А с 500 мМ имидазола).

1.9.19 Рефолдинг белка

Растворенные тельца включения перевели в буфер 3 М Мочевины 100 мМ Tris pH 8.0   с помощью колонки PD - 10 . Полученный белковый раствор разбавили буферами представленными в таблице_ , и оставляли на 48 или  72 часа при температуре 5 oC.

Таблица _ -  Буфера для проведения рефолдинга

Состав буфера

1

100 мМ TrisHCI, pH 8.0, 0.5 мM 2 - Меркаптоэтанол

2

100 мМ TrisHCI, pH 8.0, 1 мM 2 - Меркаптоэтанол

3

100 мМ TrisHCI, pH 8.0, 1 мM цистеин

4

100 мМ TrisHCI, pH 8.0, 5 мM цистеин

5

100 мМ TrisHCI, pH 8.8, 0.5 мM 2 - Меркаптоэтанол

6

100 мМ TrisHCI, pH 8.8, 1 мM цистеин

7

50 мМ TrisHCI, pH 8.0, 8 мM цистеин, 400 мМ NaCI, 0.02% Tween -20

8

50 мМ TrisHCI, pH 8.0, 8 мM цистеин, 400 мМ NaCI, 0.02% Tween -20, 5% глицирин

9

50 мМ TrisHCI, pH 8.0, 8 мM цистеин, 0.8 М аргинин

10

50 мМ TrisHCI, pH 8.0, 8 мM ДТТ, 0.8 М аргинин

11

50 мМ TrisHCI, pH 8.0, 6 мM CHAPS, 0.8 М аргинин, 15 мМ глютатион востановленный

12

50 мМ TrisHCI, pH 8.0, 6 мM CHAPS, 400 мМ NaCI, 8 мМ цистеин

1.9.20 Расщепление гибридного белка SumoNGF

2. Экспериментальные исследования

Фактор роста нервов является сигнальным белком, участвует в развитии нервной системы у позвоночных. Он осуществляет регуляцию и управление ростом аксонов, посредством механизмов клеточного сигналинга.

Современные знания  о данном белке позволяет его использовать при коррекции и лечение заболеваний центральной нервной системы, связанных с психическими расстройствами (слабоумие, депрессия, шизофрения, аутизм, синдром Ретта, анорексии и булимии, болезни  Альцгеймера). Кроме того он может участвовать в развитии сердечно – сосудистых заболеваниях (атеросклероз коронарных артерий, ожирение, сахарный диабет 2 типа). Существует доказательство того, что NGF может быть полезен в лечении кожных язв и язв роговицы.

Очевидно, что вследствие низкого содержания NGF в тканях человека, он не может быть выделен в достаточных количествах, поэтому разработка методов получения рекомбинантного человеческого NGF (rh-NGF), является актуальной проблемой современной науки и практической медицины.

Технологии с использованием рекомбинантной ДНК позволяют производить широкий спектр рекомбинантных белков человека для терапевтического применения, но попытки производства рекомбинантного NGF с использованием различных организмов пока не дали ожидаемых результатов.

В данной исследовательской работе предложен метод получения целевой последовательности рекомбинантного фактора роста нервов с помощью гибридной экспрессии с белком партнёром SUMO в клетках Ecoli. Все этапы работы выполнялись в Блоке Белковой Химии Центра «Биоинженерия» РАН.

2.1 Получение векторных конструкций.

Клонирование рекомбинантных генов и их экспрессия с образованием белковых продуктов клетками E. сoli позволяет осуществить производство многих полезных эукариотических белков, которые другим способом получить очень трудно.

В ходе экспериментальной работы были собраны две векторные конструкции для прямой и гибридной экспрессии. В качестве основы была взята коммерческая плазмида pGEMEX1 (Novagen, США).

 

Рисунок _. – Плазмиды pTNGF и pTSumoNGF. На рисунке обозначены: NGF – ген, отвечающий за синтез фактора роста нервов, SumoNGF - ген, отвечающий за синтез гибридного белка,  Ori (Origin) - регион автономной репликации и регион, f1 Ori,??? , bla (AmpR) - ген придающий устойчивость к ампицилину, Т7pr – промотор, обеспечивающий инициацию трансткипции, Т7ter – терминатор - последовательность нуклеотидов, узнаваемая РНК-полимеразой, как сигнал к прекращению синтеза РНК.

2.1.1 Сборка гена NGF методом ПЦР.

На первом этапе с помощью научной литературы была изучена последовательность олигонуклеотидов гена фактора роста нервов, который расположен на коротком плече, первой хромосомы человека []. Далее была произведена модификация данной последовательности путем добавления на 5/ конец сайта рестрикции NdeI  а на 3/ конец XhoI (Приложение _ ).

На основе данной последовательности были подобраны 12 праймеров для  последовательной сборки гена (Приложение _ ). Сборку гена NGF осуществляли в несколько этапов  c помощью метода ПЦР-амплификации (Рисунок _ ).

             

Рисунок  _. – Сборка гена NGF методом ПЦР.

В результате был собран ген человеческого фактора роста нервов, который в дальнейшем был использован для создания экспрессионных конструкций (Рисунок _ ).

                

Рисунок _ . – Ген NGF c модифицированными концами.

2.1.2 Получение векторной конструкции pTNGF

Для прямой экспрессии в используемую плазмиду по сайтам NdeI и XhoI был проклонирован ранее полученный ген, кодирующий человеческий фактор роста нервов (NGF), под транскрипционный контроль Т7 промотора. Основные этапы работы по получению pTNGF изображенны на рисунке _.

Полученную с помощью ПЦР- амплификации последовательность гена фактора роста нервов расщепляли эндонуклеазами рестрикции NdeI и XhoI. Расщепление плазмиды pGEMEX1 проходило в два этапа. Сначала рестрикции проводили по сайтам NdeI и AatII, а затем XhoI и AatII. В результате получили два вектора длиной 2092 п.о (Вектор 1)  и 1049 п.о (Вектор 2) соответственно. Контроль расщепления ДНК рестриктазами осуществлялся с помощью электрофоретического разделения ДНК в агарозном геле.

                                                                                   

Рисунок _. - Основные этапы сборки векторной конструкции pTNGF.

После выделения из геля фрагмента, проводили  трехкомпонентное лигирование (фрагмент NGF, вектор 1 и вектор 2). В результате получили  лигазную смесь, которой трансформировали компетентные клетки штамма XL1-Blue. Затем трансформированные клетки высевали на агаризованную питательную среду YT с ампициллином, в качестве селективного агента.

Бактериальные клоны анализировали на содержание нужного фрагмента быстрым ПЦР-скринингом, используя праймеры T7 и Sp6 на начало промотора и конец терминатора. (Рисунок _ ).

                       1     2      3     4       5      6     7     8      9       10     11

                                                                                                  

                                                                                    400 п.н   

 

         Рисунок _ - ПЦР – скрининг бактериальных клонов.

1-10 – плазмидная ДНК бактериальных клонов № 1 – 10, 11 – положительный контроль, фрагмент NGF.

Из результатов скрининга видно, что у всех отобранных клонов наработался фрагмент соответствующий положительному контролю. В качестве положительного контроля был взят ген NGF.  Полученные результаты свидетельствуют о наличии целевой вставки в составе вектора. Но данного исследования недостаточно, чтобы дать окончательный ответ о правильности сборки конструкции.

Отобранные для дальнейшего исследования колонии № 5 – 10 инокулировали в 3 мл YT среды  и выращивали в течении ночи при 37оС в стерильных пробирках на 15 мл. С 3 мл. ночной культуры была собрана биомасса и выделена плазмидная ДНК при помощи набора QIAprep Spin Miniprep Kit (QIAGEN). Полученные векторные конструкции секвенировали в Межинститутском Центре коллективного пользования “ГЕНОМ” Центр “Биоинженерия” РАН. Правильность последовательности ДНК гена SumoNGF и сопутствующих областей в плазмиде была подтверждена секвенированием (Приложение _ )

Правильность последовательности ДНК гена NGF и сопутствующих областей в плазмиде была подтверждена секвенированием (Приложение _ )

2.1.3 Получение гибридной последовательности SumoNGF.

Этапы получения гибридной последовательности SumoNGF представлены на рисунке _ . На первом этапе c помощью ПЦР была накоплена ДНК фрагментов NGF и SUMO. В качестве матрицы для накопления гена NGF брали заранее полученную плазмиду pTNGF и использовали прямой праймер NG и обратный праймер Sp6 (ПЦР №1). В качестве матрицы для накопления гена SUMO брали плазмиду pTS и использовали прямой праймер T7 и обратный праймер SU (ПЦР №2).  Благодаря специально подобранным праймерам каждый фрагмент имеет выступающий не амплифицирующийся конец, которые комплементарны друг другу. На втором этапе ставили ПЦР №3. В качестве матрицы брали полученные фрагменты SUMO и NGF и используя прямой праймер Т7 на SUMO  и обратный праймер на NGF.В  результате комплементарного  взаимодействия двух последовательностей получили фрагмент SumoNGF, который в дальнейшем использовался для создания экспрессионной конструкции.

                            

Рисунок _. - Этапы получения гибридной последовательности SumoNGF

2.1.4 Получение векторной конструкции pTSumoNGF.

Экспрессионная плазмида для гибридной экспрессии собиралась аналогично первой конструкции. Полученную вышеуказанным способом последовательность гена гибридного белка с SUMO проклонировали  по сайтам рестрикции NdeI и XhoI.в плазмиду pGEMEX1. Лигазную смесью, трансформировали компетентные клетки штамма XL1-Blue. Затем трансформированные клетки высевали на агаризованную среду YT с ампициллином, в качестве селективного агента

Основные этапы  для сборки векторной конструкции pTSumoNGF представлены на рисунке_

                     

Рисунок _. - Основные этапы сборки векторной конструкции pTSumoNGF.

               1             2       3      4     5       6      7      8       9     10     11      

                  

                       1     2       3      4      5       6      7      8     9   

                10             11    12     13    14    15    16     17    18

       

      12      13             14    15    16    17     18    19     20    21    22

Рисунок _ - ПЦР – скрининг бактериальных клонов.

1, 12 – ДНК маркер, 2-10,13 -21 - плазмидная ДНК бактериальных клонов № 1-18, 11, 22 - положительный контроль, фрагмент NGF.

Бактериальные клоны анализировали на содержание нужного фрагмента быстрым ПЦР-скринингом, используя праймеры SMseq и Sp6 на начало и конец последовательности SumoNGF (Рисунок _ ).

Результаты скрининга  показали, что у всех клонов кроме №14 и №18  наработался фрагмент теоретически рассчитанного размера (Рисунок _ ). Это говорит о том что лигирование прошло правильно  Для дальнейшего исследования было отобрано 10 клонов (№ 1, 2, 6, 7, 9, 10 , 11, 13, 15, 17 ). Плазмиды отобранных клонов анализировали с помощью рестриктного анализа по сайтам рестрикции

   1        2      3     4      5     6      7      8      9    10    11     12

 

       Рисунок _ . – Рестрикционный анализ плазмиды pTSumoNGF

1. –ДНК маркер, 2 -11. - рестрикционный анализ плазмид клонов № 1, 2, 6, 7, 9, 10 , 11, 13, 15, 17 соответственно, 12. – положительный контроль плазмида pGEMEX1.

Перечисленные бактериальные инокулировали в 3 мл YT среды  и выращивали в течение ночи при 37оС в стерильных пробирках на 15 мл. С 3 мл. ночной культуры была собрана биомасса и выделена плазмидная ДНК при помощи набора QIAprep Spin Miniprep Kit (QIAGEN). Полученные векторные конструкции № 1, № 2, №6, № 7, № 9 были отданы в Межинститутский Центр коллективного пользования “ГЕНОМ” Центр “Биоинженерия” РАН. Правильность последовательности ДНК гена SumoNGF и сопутствующих областей в плазмиде была подтверждена секвенированием (Приложение _ )

2.2 Биосинтез целевого и гибридного белка. Подбор условий культивирования.

2.2.1 Биосинтез белка NGF.

Для наработки целевого белка NGF производили трансформацию клеток штамма E.coli BL21(DE3) полученной векторной конструкцией pTNGF. Культивирование проводили при температуре 37oС  в течении 24 часов на автоиндукционной среде TB – 5052 и средах с различной концетрацией ИПТГ. Изопропил-β-D-1-тиогалактопиранозид (ИПТГ, англ. IPTG) — реагент, используемый в молекулярной биологии. ИПТГ используют в качестве аналога аллолактозы, метаболита лактозы, который запускает транскрипцию lac-оперона [].

По окончанию культивирования штамма – продуцента, анализ экспрессии осуществляли с помощью белкового электрофореза (Рисунок _ ).

Результаты эксперимента показывают, что больше всего белка накапливалось в культуральной жидкости при выращивании на автоиндукционной среде. Данный белок имел молекулярную массу около 32 кДа, что не соответствует подвижности фактора роста нервов. Согласно литературным источником данную молекулярную массу имеет фермент β-лактамаза, который отвечает за резистентность бактерий к бета –лактамным антибиотикам. Накопление данного фермента в больших количествах говорит о том, что прямая экспрессия NGF не идет []

             1      2      3     4      5     6      7       8    9     10     11   12    13

32 кДа

25 кДа

Рисунок _ - Анализ экспрессии NGF на автоиндукционой среде и средах с ИПТГ.  Температура культивирования 37°С. Клетки E.coli BL21(DE3). 

  1.   Белковый маркер молекулярной массой 25 кДа.
  2.  Автоиндукционная среда. Культуральная жидкость.
  3.  Автоиндукционная среда. Клетки.
  4.  Концентрация индуктора IPTG 0 мМ. Культуральная жидкость.
  5.  Концентрация индуктора IPTG 0 мМ. Клетки.
  6.  Концентрация индуктора IPTG 0.01 мМ. Культуральная жидкость.
  7.  Концентрация индуктора IPTG 0.01 мМ. Клетки.
  8.  Концентрация индуктора IPTG 0.05 мМ. Культуральная жидкость.
  9.  Концентрация индуктора IPTG 0.05 мМ. Клетки
  10.   Концентрация индуктора IPTG 0.25 мМ. Культуральная жидкость.
  11.   Концентрация индуктора IPTG 0.25 мМ. Клетки
  12.   Концентрация индуктора IPTG 1 мМ. Культуральная жидкость.
  13.   Концентрация индуктора IPTG 1 мМ. Клетки

Данный опыт говорит о том, что кишечная палочка не может синтезировать фактор роста нервов при прямой экспрессии. Возможно данный факт может быть объяснен небольшой молекулярной массой целевого белка,  а также наличием трёх дисульфидных связей, которые стабилизируют молекулу. Все это усложняет биосинтез белка, так как кишечная палочка не способна правильно формировать дисульфидные связи из–за более восстановленного  прокариотического цитозоля по сравнению с эукариотическим. В результате белок имеет неупорядоченную структуру и подвергается воздействию протеиназ, которые расщепляют его, а синтезируются другие бактериальные белки.

2.2.1 Биосинтез гибридного белка SumoNGF.

Для решения проблемы, возникшей при прямой экспрессии NGF, был предложен метод гибридной экспрессии. Технология гибридной экспрессии открывает широкие возможности для очистки рекомбинантных белков. В качестве партнеров для слияния можно выбрать разные последовательности, например, гексагистидиновый фрагмент, стрептавидин, MBP. После чего изолировать рекомбинантный белок становится достаточно просто, используя аффинные смолы, где в качестве функциональных групп присутствуют никель-нитрилтриуксусная кислота, биотин или амилоза соответственно. Таким образом, очистка рекомбинантных белков заметно упрощается, стоит только подобрать подходящий аффинный фрагмент (таг) и смолу. Еще более удобным процесс получения рекомбинантных белков делает доступность коммерческих векторов, уже содержащих последовательности белков-партнеров [].

Присоединение тагов к целевому белку также полезно при идентификации рекомбинантного белка. В данном случае целесообразно использовать антитела к таким добавкам [].

Для гибридной экспрессии был выбран белок – партнёр SUMO (small-ubiquitin-related-modifier). Это небольшой, примерно 100 аминокислотных остатков белок, модулирующий структуру и функцию эукариотических белков путем ковалентной модификации. Известно три высокогомологичных гена SUMO у млекопитающих и только один у Saccharomyces cerevisiae.

Пространственная структура SUMO сходна с пространственной структурой убиквитина, и представляет собой плотную глобулярную структуру, где β-слои обернуты вокруг одной α-спирали.

При синтезе целевого белка в слитом с SUMO виде, наблюдается заметное увеличение экспрессии гена рекомбинантного белка, кроме того, увеличивается его растворимость []. Влияние SUMO на растворимость, видимо, связано со структурой данного белка. Его внешняя гидрофильная оболочка и внутренний гидрофобный кор могут оказывать тот же эффект, что и детергенты при солюбилизации.

Другим положительным качеством слитной продукции с SUMO является простота расщепления гибридных продуктов SUMO-гидролазами. Для расщепления гибридного белка они не требуют наличия специфической последовательности и не модифицируют N-конец целевого белка. Поскольку SUMO-гидролазы узнают третичную структуру SUMO, а не специфическую последовательность, то могут быть использованы самые разные партнеры для гибридной экспрессии. Единственным ограничением является продукция целевых белков с N-концевым пролином, поскольку SUMO-гидролазы не могут расщепить такие гибриды. SUMO-гидролазы очень устойчивы, доступны коммерчески, кроме того, они эффективны в широком диапазоне температур (4-37oC),  pH (pH 6-10,5) и в присутствии различных хроматографических реагентов [].

Для экспрессии гена NGF в составе ранее полученной плазмиды pTSNGF был выбран штамм E. coli BL21 (DE3). После трансформации бактериальных клеток осуществляли подбор условий культивирования. Для выращивания рекомбинантного штамма использовались среды автоиндукционные среды TB – 5052, 2 ZYM – 5052 а также неавтоиндукционная среда MGD +. Заражали 1 колонией на 1 мл. среды. Культивирование проводили в течении 24 часов при температурах 37 oC и 25 oC.

По окончанию инкубации из каждой колбы отбирали образцы для белкового электрофореза (Рисунок _ ) Отобранные образцы разделяли на культуральную жидкость и биомассу и наносили на гель.

100 кДа

75 кДа

50 кДа

37 кДа

25 кДа

20 кДа

10 кДа  

  

               1          2       3     4      5     6     7      8     9     10    11   12   13    

Рисунок _- Подбор условий культивирования штамма – продуцента гибридного белка SumoNGF.  

  1.  Белковый маркер.
  2.  Биомасса клеток. Автоиндукционная среда TB – 5052, 37 oC
  3.  Культуральная жидкость. Автоиндукционная среда TB – 5052, 37 oC
  4.  Биомасса клеток. Автоиндукционная среда TB – 5052, 25 oC
  5.  Культуральная жидкость. Автоиндукционная среда TB – 5052, 25 oC
  6.  Биомасса клеток. Автоиндукционная среда 2ZYM – 5052, 37 oC
  7.  Культуральная жидкость. Автоиндукционная среда 2ZYM – 5052, 37 oC
  8.  Биомасса клеток. Автоиндукционная среда 2ZYM – 5052, 25 oC
  9.  Культуральная жидкость. Автоиндукционная среда 2ZYM – 5052, 25 oC
  10.   Биомасса клеток. Автоиндукционная среда MGD +, 25 oC
  11.   Культуральная жидкость. Автоиндукционная среда MGD +, 25 oC

Было обнаружено, что максимальный уровень синтеза гибридного белка наблюдается в клетках, при культивировании на автоиндукционных средах TB – 5052 и 2ZYM – 5052 при 37 oC. На среде MGD + накопление нужного белка не происходило. При масштабировании культивирования микроорганизма – продуцента автоиндукциоонные среды заражали 3 колониями на 1 мл. В результате  было установлено, что наиболее благоприятной средой для выращивания трансформированных клеток бактерий является автоиндукционная среда 2ZYM – 5052, при выращивании на которой концентрация белка фактора роста нервов 1г/мл (Рисунок _ ).

Рисунок _ - Экспрессия гибридного белка SumoNGF,   при                      выращивании штамма – продуцента на среде 2ZYM – 5052.

1,2. Экспрессия гибридного белка SumoNGF

 

 

    1         2

При оптимизации культивирования было установлено, что при температуре 37°С  SumoNGF накапливается в клетках в виде телец включения (Рисунок  _).

                     1                         2          3          4     

75кДа                

50 кДа  

37 кДа

25 кДа

20 кДа

15 кДа

10 кДа  

Рисунок _. - Анализ клеток на растворимый и нерастворимый белок.

  1.  Белковый маркер
  2.  Фракция общего белка клеток
  3.  Фракция нерастворимого белка клеток
  4.  Фракция растворимого белка клеток

Индуцибельные системы экспрессии, в которых Т7 РНК – полимераза транскрибирует, клонированные под Т7 Lac - промотор последовательности, в настоящее время эффективно используются для получения большого разнообразия белков в Escherichia coli. Особое внимание уделяется автоиндукционным питательным средам.

Идея автоиндукции состоит в том, чтобы полностью блокировать активность гена до момента индукции. Практически это реализуется путем добавления в среду глюкозы и лактозы в определенном соотношении. Глюкоза является репрессором, а лактоза – активатором экспрессии генов, стоящих под контролем Lac-промотора. Присутствие глюкозы позволяет подавить базальную транскрипцию, что дает возможность трансформированным клеткам активно делиться. К тому моменту, как запасы глюкозы в среде истощаются, трансформированная культура клеток уже достигает достаточно высокого значения оптической плотности (2-3 о.е.). Истощение запасов глюкозы вынуждает клетки использовать лактозу в качестве источника углерода. Поскольку лактоза является активатором транскрипции, запускается экспрессия гена SumoNGF. Автоиндукционные среды более практичны и позволяют уменьшить в несколько раз количество колб при оптимизации условий выращивания культур. Стабильность и жизнеспособность культур, выращенных в автоиндукционных средах позволяет работать с ними при замораживании в течении нескольких недель. Автоиндукция удобна, эффективна и экономична для того, чтобы произвести белки в почти любом масштабе, от анализа индивидуальных белков в небольших лабораториях к производству многих различных белков в крупных проектах, и возможно даже для производства белков в коммерческих масштабах [].

2.3 Выделение и очистка рекомбинантного фактора роста нервов

человека.

При экспрессии эукариотических генов в бактериальных клетках часть рекомбинантных эукариотических белков и некоторые прокариотические белки при высоком уровне биосинтеза переходят в нерастворимое состояние, образуя так называемые тельца включения.

Тельца включения представляют собой частицы, состоящие из агрегатов рекомбинантного белка и ряда бактериальных белков. Рекомбинантные белки в тельцах включения находятся в денатурированном неактивном состоянии, и для их получения в растворимом виде приходится применять мощные денатурирующие агенты, такие как мочевина, гуанидинхлорид и детергенты [].

2.3.1 Отмывка и растворение телец включения

Биомассу замороженных клеток подвергали ультразвуковой дезинтеграции в следующих лизис буферах:  a) 50 мМ Tris pH 8.0  и 0.1 % Triton, б) 50 мМ Tris pH 8.0 и 100 мМ NaCI. Нерастворимую фракцию лизата клеток осаждали центрифугированием.

На следующем этапе осуществляли подбор условий растворения отмытых телец включения (Рисунок _ ).

          1      2      3         4       5      6      7        8      9      10      11    12                     

   Рисунок _ - Подбор условий растворения отмытых телец включения.

1, 3, 5, 7, 9, 11 – супернатант; 2,  4, 6, 8, 10, 12 – осадок.

1, 2. Растворение буфером № 1, культивирование клеток при 25oC

3, 4.  Растворение буфером № 1, культивирование клеток при 37oC

5, 6. Растворение буфером № 2, культивирование клеток при 25oC

7, 8. Растворение буфером № 2, культивирование клеток при 37oC

9, 10.  Растворение буфером № 3, культивирование клеток при 25oC

11, 12. Растворение буфером № 3, культивирование клеток при 37oC

(Смотри метод 1.9.17 )

Как показывают результаты, частичный переход белка в растворенное состояние наблюдается только  в буфере № 3, содержащем 5 M мочевину. Но этого не достаточно для дальнейших исследований и поэтому нами был рассмотрен метод растворения телец включения в буфере № 4 с 3.5 М гуанидингидрохлоридом [].

При использовании данного буфера происходит почти полное растворение телец включения (Рисунок _ ).

50 кДа

37 кДа

Рисунок _ - Растворение телец включения в              буфере с 3.5 М гуанидингидрохлоридом.

  1.  

25 кДа

Белковый маркер

  1.  Отмытые тельца включения
  2.  

20 кДа

Растворение буфером № 4

15 кДа

    (Смотри метод 1.9.17 )

10 кДа

                 1        2        3  

Во время денатурации важно, чтобы белок сохранял вторичную структуру. Это является важным фактором с точки зрения эффективности рефолдинга, так как это связано с функциональной способностью молекулы ренатурировать в правильном направлении.

Растворенный гибридный белок в буфере с 3.5 М гуанидингидрохлоридом в дальнейшем использовался для очистки при помощи металло-хелатной аффинной хроматографии.  

2.3.2 Металло-хелатная аффинная хроматография

 SUMO, входящий в состав гибридного белка, содержит последовательность из шести гистидинов (His-таг). Очистка белков, содержащих полигистидиновые последовательности, в техническом плане  имеет ряд преимуществ перед белками, не содержащими такие последовательности. Так становится возможным применение металло –хелатной аффинной хроматографии (МХАХ), в основе которой лежит образование прочного комплекса, образующегося между His6-последовательностью и ионами металла (чаще всего Ni2+ или Co2+), которыми заряжен хроматоргафический носитель.

На колонку, уравновешенную буфером А, наносили подготовленный образец, после чего промывали колонку тем же буфером А. При этом происходило отмывание всех не связавшихся с колонкой белков E. coli. Все не специфически связавшиеся бактериальные белки удалялись с колонки при повышении концентрации имидазола. Для элюции были опробованы буферы B и С, с содержанием имидазола 50 и 500 мМ соответственно (Рисунок _ ).

75 кДа

     1        2     3    4       Рисунок _ - Очистка белка с помощью МХАХ

  1.  

50 кДа

Белковый маркер

  1.  

37 кДа

Проскок

  1.  

25 кДа

Элюция № 1

  1.  Элюция № 2

20 кДа

10 кДа

Из рисунка _  видно, что основная часть рекомбинантного белка сходит при элюции с концентрацией имидазола 500 мМ. Использование высокой концентрации имидазола позволяет снизить концентрацию NaCl в буфере для элюции с 500 мМ до 150 мМ, что необходимо для дальнейшего рефодинга рекомбинантного белка.

2.3.3 Масс-спектрометрия гибридного белка NGF

В подтверждения того, что полученный нами белок действительно является гибридным белком SumoNGF, вырезанные  полосы из геля передали на масс-спектрометрический анализ на приборе Ultraflex Tof/Tof (Bruker Daltonik). Белковые полосы подвергались трипсинолизу, после чего масс-спектр положительно заряженных ионов снимался в отражательном режиме с использованием 2,5-дигидроксибензойной кислоты в качестве матрицы. Количество выявленных при помощи масс-спектрометра пептидных фрагментов, соответствующих последовательности SumoNGF (sequence coverage 36.7%), позволяет утверждать, что полученный нами белок действительно является гибридным белком SumoNGF (Приложение _ )

2.3.4 Рефолдинг гибридного белка SumoNGF

Известно, что ренатурация in vitro протекает по пути, в основном повторяющему природный, но в искусственной среде путь может разветвляться, приводя в итоге к неправильному сворачиванию полипептидных цепей. Правильное протекание процесса зависит от условий среды, которые не должны препятствовать реализации нативной структуры белка. Температура, состав, рН среды, условия проведения, концентрация белка и денатурирующего агента оказывает существенное влияние на рефолдинг белка []. Оптимальные условия проведения ренатурации не поддаются строгой систематизации и являются уникальными для каждого конкретного белка.

Подбор условий проведения рефолдинга для исследуемого гибридного белка  осуществляли согласно литературным данным [ , , ]

На первом этапе данной части исследовательской работы проводили обессоливание раствора гибридного белка с помощью колонки PD - 10 Растворенные тельца включения перевели в буфер 3 М Мочевины 100 мМ Tris pH 8.0.

Далее рефолдинг проводили по схемам указанным в таблице _.

Таблица _  - Схемы проведения рефолдинга.

№ буфера

Условия рефолдинга

1

Белковый раствор разбавляли в 12 раз до концентрации белка 0.2 мг/мл и экспозиционировали 48 часов в холодильнике.

2

Белковый раствор разбавляли в 12 раз до концентрации белка 0.2 мг/мл и экспозиционировали 48 часов в холодильнике.

3

Белковый раствор разбавляли в 12 раз до концентрации белка 0.2 мг/мл и экспозиционировали 48 часов в холодильнике.

4

Белковый раствор разбавляли в 12 раз до концентрации белка 0.2 мг/мл и экспозиционировали 48 часов в холодильнике.

5

Белковый раствор разбавляли в 12 раз до концентрации белка 0.2 мг/мл и экспозиционировали 48 часов в холодильнике.

6

Белковый раствор разбавляли в 12 раз до концентрации белка 0.2 мг/мл и экспозиционировали 48 часов в холодильнике.

7

Белковый раствор разбавляли в 10 раз до концентрации белка 0.1 мг/мл и экспозиционировали 72 часов в холодильнике

8

Белковый раствор разбавляли в 10 раз до концентрации белка 0.1 мг/мл и экспозиционировали 72 часов в холодильнике

№ буфера

Условия рефолдинга

9

Белковый раствор разбавляли в 10 раз до концентрации белка 0.1 мг/мл и экспозиционировали 72 часов в холодильнике

10

Белковый раствор разбавляли в 10 раз до концентрации белка 0.1 мг/мл и экспозиционировали 72 часов в холодильнике

11

Белковый раствор разбавляли в 10 раз до концентрации белка 0.1 мг/мл и экспозиционировали 72 часов в холодильнике

12

Белковый раствор разбавляли в 10 раз до концентрации белка 0.1 мг/мл и экспозиционировали 72 часов в холодильнике

По окончанию рефолдинга результаты анализировались с помощью белкового электрофореза по методу Лэммли (Рисунки _ и _ ).

                №1 №2 №3 №4 №5 №6                      №1 №2 №3 №4 №5 №6

Б

А

    1          2    3    4    5   6    7                 8     9   10   11 12  13

Рисунок _ - Результаты рефолдинга с использованием схем № 1 – 6

А. Белковый электрофорез с 2 –меркаптоэтанолом

Б. Белковый электрофорез без 2 –меркаптоэтанола

1. Белковый маркер, 2 – 13. Результаты рефолдинга схем № 1 – 6

                 №7 №8 №9 №10 №11  №12           №7  №8 №9  №10 №11 №12

                 1   2   3      4      5       6      7            8   9      10    11   12   13

                                         А                                                 Б

    Рисунок _ - Результаты рефолдинга с использованием схем № 7 – 12

А. Белковый электрофорез с 2 –меркаптоэтанолом

Б.  Белковый электрофорез без 2 –меркаптоэтанола

1. Очищенный  гибридный белок с помощью МХАХ

2 – 13. Результаты рефолдинга схем № 7 – 12

При использовании схем № 1 – 6 существенная часть белка SumoNGF после ренатурации находилась в виде агрегатов, а так же на вторые сутки рефолдинга на электрофорезе без 2 - меркаптоэтанола пропали полосы соответствующие димеру. Что делает нецелесообразным использовать их в дальнейшем.

Для решения данной проблемы нами были предложены схемы № 7 – 12. В результате гибридного белка в виде агрегатов стало меньше, а полосы на электрофорезе без 2 – меркаптоэтанола на 2 и 3 сутки не пропадали. Лучше всего рефолдинг прошел при использовании схемы № 10 с 0.8 мМ аргинином, где почти не наблюдалось агрегатов.

В дальнейшем данная схема рефолдинга была использована для получения белка в нативной комформации.

2.3.5 Ферментативное расщепление гибридного белка SumoNGF

Белковый раствор  после рефолдинга содержал высокую концентрацию аргинина (0.8 М), что могло отрицательно сказаться на ферментативном расщеплении гибридного белка. Для снижения аргинина в образце был использован диализ. В данном случае самопроизвольное расщепление белка не так существенно, как при выделении гибридного белка, поскольку конечным продуктом очистки является NGF. Диализованный  образец профильтровали через фильтр с диаметром пор 0,22 мкм, после чего поставили ферментативное расщепление гибридного белка Ulp1 - гидролазай при 4°С в течение ночи. Подбор концентрации фермента приведен на рис _

                     

                 

20кДа

15кДа

А

13 кДа афакДа

Б

10 кДа

 

                                        1        2          3       4       5

Рисунок _ - Подбор концентрации Ulp1 для гидролиза гибридного белка SumoNGF.

1. 5 ед. Ulp1- гидролазы на 1 мг белка

2. 10 ед. Ulp1 - гидролазы на 1 мг белка

3. 20 ед. Ulp1 - гидролазы на 1 мг белка

4. 40 ед. Ulp1 - гидролазы на 1 мг белка

5. Белковый маркер

А. Белок NGF, Б. Белок SUMO

Так расщепление идет во всех случаях одинаково, то с экономической точки зрения выгоднее всего использовать минимальную концентрацию фермента.

2.3.5 Очистка NGF на катионобменной хроматографии.

Для разделения продуктов гидролиза гибридного белка SumoNGF проводили катионобменную хроматографию. Одним из основных условий для проведения данного вида хроматографии является наличие заряда у выделяемого белка. Исходя из этого факта, необходимо выбирать такие значения pH, где белок будет максимально заряжен.  Расчетная изоэлектрическая точка NGF лежит в районе 9 (pI 8,92), в то время как расчетная изоэлектрическая точка SUMO около 6  (pI 5,58).

С помощью программы________ были построены кривые титрования для белков SUMO и NGF (Рисунок _ )

                              А                                                         Б

Рисунок  _ - Кривые титрования. А. NGF, Б. SUMO

На основании данных кривых был выбран рабочий pH 5.0, при котором NGF положительно заряжен, а SUMO имеет отрицательный заряд. Хроматографию проводили на SPsepharose FF (1мл.) .

1

2

Рисунок _ - Катионобменная хроматография на SPsepharose FF

  1.  Белок SUMO 2. Белок NGF.

При таком значении pH c колонкой связался только NGF, имеющий положительный заряд и вышел одним острым пиком (Рисунок _ ). Результаты хроматографии представлены на рисунке  _

                                                        Рисунок _ - Очистка белка NGF

  1.  Расщепленный гибридный белок
  2.  NGF после очистки на SPsepharose FF

13.4 кДа

 12 кДа

  1.  2

В результате  катионобменной хроматографий был получен белок с частотой выше 90 % частоты в количестве 5 мг с литра клеточной суспензии. Выход не большой, но уже больше чем можно выделить из тканей человека.

2.3.5 Разработка обобщённой схемы производства рекомбинантного NGF

По результатам данной дипломной работы была составлена обобщённая технологическая схема производства рекомбинантного фактора роста нервов (Рисунок _ ). При наличии штамма – продуцента, производство можно начинать, со стадии ферментации.

 

   

Организационно – экономический раздел

  1.  Технико-экономическое обоснование НИР

Фактор роста нервов (англ. nerve growth factor, NGF) один из нейротрофинов,  кодируемый у человека геном NGF на коротком плече 1-й хромосоме. Представляет собой небольшой секретируемый белок. NGF играет важную роль в дифференцировке нервных клеток, а также ускоряет рост и улучшает выживание аксонов.

В связи свыше сказанным фактор роста нервов является белком, определяющим развитие симпатической нервной системы, благодаря стимуляции нервных клеток. NGF отвечает за запуск множества метаболитических путей внутри клетки, тем самым обладая большим терапевтическим потенциалом для лечения болезней в которых задействованы эти реакции.

 Современные знания  о данном белке позволяет его использовать при коррекции и лечение заболеваний центральной нервной системы, связанных с психическими расстройствами (слабоумие, депрессия, шизофрения, аутизм, синдром Ретта, анорексии и булимии, болезни  Альцгеймера). Кроме того он играет важную роль в сердечно – сосудистых заболеваниях (атеросклероз коронарных артерий, ожирение, сахарный диабет 2 типа). Существует доказательство того, что NGF может быть полезен в лечении кожных язв и язв роговицы.

Все выше сказанное говорит о том, что создание лекарственных препаратов на основе фактора роста нервов является социально значимой проблемой. Данный белок практически невозможно выделить из природных источников. Поэтому  перспективным является  получение биологически активного фактора роста нервов в гетерологичных экспрессионных системах. Анализ литературы по данной проблеме показывает небольшое количество информации, что говорит об актуальности и перспективе получения рекомбинантного NGF.

2. Расчёт затрат на научно-исследовательскую работу

2.1. Расчет материальных затрат (Cм)

Расчет затрат на основные и вспомогательные материалы, реактивы, израсходованные при выполнении дипломной работы можно определить следующим образом:

См=∑Рi∙Цi, где

Рi- количество израсходованного i-го материального ресурса, ед.;

Цi- планово-заготовительная цена единицы i-го вида материальных ресурсов, руб./ед.;

i-1,2,…n- виды ресурсов.

Расчет затрат на основные и вспомогательные материалы, реактивы, израсходованные при выполнении дипломной работы представлены в таблице 1.

Таблица 1. - Расчет материальных затрат

 

Наименование

Ед.

изм.

Кол-во,

ед.

Цена,

руб./ед.

Сумма,

Руб.

1

Трис-HCl

5 кг

0,05

5886, 00

294,3

2

Борная кислота (H3BO3)

0,5 кг

0,1

220,30

44,06

3

Бромистый этидий

25 мл

0,004

918,30

3,7

4

ЭДТА

500 г

0,04

1093,12

43,7

5

Глицерин

1 кг

0,03

300,01

9,0

6

SDS

1 кг

0,005

1101,90

5,51

7

Бромфеноловый синий

5 г

0,002

250

0,5

8

Наборы реактивов для выделения и очистки ДНК: GelElute  Plasmid Miniprep Kit

350 очисток

0,0086

13623,50

116,77

9

Наборы реактивов для выделения и очистки ДНК: QIAprep Spin Miniprep Kit

350 очисток

0, 012

12765,00

153,18

10

Эндонуклеаза рестрикции: Xho I

10 Ед

0,02

2572

51,44

11

Эндонуклеаза рестрикции: Nde I

20 Ед.

0,02

2367

47,34

12

Pfu - polymerase

500Ед.

0,02

2163

43,26

13

KAPA 2G-polymerase

500Ед.

0,02

12000

240

14

T4 DNA-lygase

500Ед.

0,01

2572,00

25,72

15

Агароза

100 г

0,07

2754,80

192,8

16

Олигонуклеотидные праймеры (2 праймера)

мкл

0,1

1802, 00

180,2

17

Бакто-триптон

500 г

0,08

3671

294

18

Дрожжевой экстракт

500 г

0,16

3364

538,2

19

Натрий хлористый (NaCl)

1 кг

0,1

270,67

27,1

20

Бакто-агар

500 г

0,022

6450,5

142,1

21

APS

50 г

0,16

168,17

26,9

22

2-меркаптоэтанол

100 мл

639,06

6,4

23

Уксусная кислота

3 л

0,4

256,65

103

24

Кальций хлористый 2Н2О (СaCl2)

500 г

0,002

368,6

0,7

25

PEG

500 г

0,0015

3354,26

5,0

26

KH2PO4

1 кг

0,048

369,98

17,8

27

Натрий фосфорнокислый двузамещенный 2Н2О (Na2HPO4·2H2O)

1 кг

0,046

804

37

28

Аммоний сернокислый ((NH4)2SO4)

500 г

0,05

324.81

16,3

29

Глюкоза

500 г

0,02

324,81

6,5

30

Лактоза

500 г

0,03

919,71

27,6

31

Магний сернокислый 7Н2О (MgSO4*7Н2О)

500 г

0,024

308,69

7,4

32

Канамицин

50 г

0,05

5935,24

296,8

33

Сахароза

500 г

0,07

293,60

20,6

34

Фенилметилсульфонилфторид (PMSF)

5 г

0,0128

1009,03

13,0

35

Мочевина

1 кг

   0.5

    836

418

36

Глицин

1кг

0,02

1348,56

27

37

Имидазол

1кг

0,015

1039,92

15,6

38

Соляная кислота (HCl)

1 л

0,35

113,28

39,6

39

Натрий гидроокись (NaOH)

1 кг

0,025

498

12,45

40

Спирт этиловый

17,3 л

0,046

1500

70

Итого

3619,97 руб.

Цены на материалы взяты из прайс-листа ООО «ДИА-М».

Борная кислота (H3BO3) ГОСТ 18704-78; соляная кислота (HCl) ГОСТ 14261-77; натрий гидроокись (NaOH) ГОСТ 4328-77; спирт этиловый ГОСТ 5962-77.

2.2. Энергетические затраты.

Затраты на электроэнергию рассчитываются по формуле:

               n           n

Сэл./эн.= ∑Рi∙Ц=∑Мi∙К∙Тi∙Ц

               i=1        i=1

Рi- расход электроэнергии на i-том виде оборудования, кВт∙ч;

Мi- паспортная мощность электрооборудования, кВт;

К- коэффициент использования мощности, К=0.8-0.9;

Тi- время работы электрооборудования, ч.;

Ц- цена 1 кВт∙часа, руб./кВт∙ч

Все полученные результаты расчетов представлены в таблице 2

Таблица 2. - Расчет затрат на электроэнергию.

Наименование оборудования

Число                единиц                           

оборудования, шт

Номинальная мощность

ед. оборудования, кВт∙ч

    

Коэф. использования      

мощности

Время           работы

оборудования, ч

Цена   за    1   кВт∙ч,

руб./кВт∙ч

Доля использования оборудования

Сумма затрат, руб.

1

Центрифуга

1

0,8

0,8

60

5

0,7

134,4

2

Настольная

микроцентрифуга

2

0,4

0,8

30

5

1

96

3

Термомиксер

1

0,2

0,8

6

5

0,3

15,84

4

Амплификатор для ПЦР

1

0,15

0,8

10

5

0,2

1,2

5

pH-метр

1

0,05

0,8

5

5

0,7

0,7

6

Горизонтальная камера для электрофореза нуклеиновых кислот

1

0,015

0,8

5

5

0,3

0,09

7

УФ-трансиллюминатор

1

0,055

0,8

1

5

0,2

26,4

8

Воздушный термостат

1

0,5

0,8

400

5

0,3

240

9

Мешалка

2

0,025

0,5

120

5

0,7

10,5

10

Мешалка

c подогревом

1

0,625

0,5

2

5

0,1

0,31

11

Вакуумный насос

1

0,05

0,8

120

5

0,7

16,8

12

Установки для очистки воды

1

0,07

0,8

460

5

1

128,8

13

Напольный инкубатор-шейкер

1

1

0,5

700

5

0,8

1400

14

Кельвинатор

1

0,7

0,8

2880

5

1

8064

15

Холодильник

3

0,15

0,8

2880

5

1

5814

16

Ламинарный бокс

1

0,2

0,8

45

5

0,3

10,8

17

Автоклав

1

2

0,8

20

5

0,5

80

18

Сверхточные весы

1

0,05

0,8

1

5

0,2

0,04

19

Вертиктикальная камера для электрофореза белков

1

0,015

0,8

50

5

0,8

2,4

20

Ультразвуковой дезинтегратор

1

0,45

0,5

9

5

0,5

5,1

21

Хроматограф

1

0,12

0,8

400

5

0,5

96

22

Спектрофотометр

1

0,1

0,8

120

5

1

48

23

Компьютер

1

0,3

0,8

1000

5

1

1200

Итого

17391,38

Затраты на различные виды водных ресурсов представлены в таблице 3.

Таблица 3. -  Расчет затрат на воду.

Вид ресурса

Израсходованное

количество, м3

Цена, руб./м3

Сумма затрат, руб.

1

Вода водопроводнаяхолодная

15

21,84

327,60

2

Вода дистиллированная

0,8

10000

8000

3

Вода очищенная

0,7

22500

15750

Итого

24077,60

4.2.3. Расчет затрат на заработную плату.

Суммарная заработная плата состоит из заработной платы исполнителя (студента) - ЗПЛис. и заработной платы руководителя дипломной работы- ЗПЛрук.

ЗПЛис.=См∙n, где

См- месячная стипендия, руб.

См=2500 руб./мес.

n- количество месяцев выполнения дипломной работы.

n=6 мес.

ЗПЛрук.=35∙Т, где

80 - общая нагрузка по руководству дипломной работой, ч

Т - часовая оплата труда руководителей на момент расчета.

Т= 450 руб./ч.

ЗПЛ (доп) – премия в размере 20 %

ЗПЛис.=10∙2500=25000 руб.

ЗПЛис (доп)=25000*0,2=5000  руб

ЗПЛис (сум)=25000 +5000=30000 руб.

ЗПЛрук.=80∙450=36000 руб.

ЗПЛрук (доп)=36000*0,2=7200 руб.

ЗПЛрук (сум)= 36000+ 7200=43200 руб.

Суммарная заработная плата:

ЗПЛсум.= ЗПЛис.+ ЗПЛрук.=43200 +30000 =73200 руб.

Отчисления на социальные нужды составляют 30% от заработной платы руководителя с доп. начислениями:

О.с.н.=43200*0.30=12960 руб.   Итого: 73200+12960=86160 руб.

2.4. Расчет затрат на стеклянную посуду, стеклянные приборы и пластик.

Затраты на стеклянную посуду  и пластик представлены в таблицах 4 и 5.

Таблица 4. - Расчет затрат на стеклянную посуду.

№ п/п

Наименование посуды

Количество, шт.

Стоимость единицы, руб.

Сумма, руб.

1

Коническая колба 150 мл

7

69,15

484,05

2

Коническая колба 250 мл

2

73,22

146,44

3

Стакан лабораторный 10 мл

2

65,89

131,78

4

Стакан лабораторный 25 мл

3

63,52

190,56

5

Стакан лабораторный 50 мл

3

62,28

186,84

6

Стакан лабораторный 100 мл

2

61,37

122,74

7

Стакан лабораторный 150 мл

2

63,63

127,26

8

Стакан лабораторный 250мл

2

63,63

127,26

9

Стакан лабораторный 1000 мл

1

135,59

135,59

10

Цилиндр 25 мл

1

185,61

185,61

11

Цилиндр 50 мл

2

198,60

397,2

12

Цилиндр 100 мл

2

220,13

440,26

13

Цилиндр 250 мл

1

325,73

325,73

14

Цилиндр 500 мл

1

445,54

445,54

15

Цилиндр 1000мл

1

674,60

674,6

16

Банка с крышкой 100 мл

5

86,44

432,2

17

Банка с крышкой 250 мл

10

91,36

913,6

18

Банка с крышкой 500 мл

5

115,25

576,25

19

Банка с крышкой 1000 мл

2

144,30

288,6

20

Банка с крышкой 2000 мл

3

376,20

1128,6

Итого

7460,71

.

Таблица 5. - Расчет затрат на  материалы из пластика.

№ п/п

Наименование пластика

Количество, шт.

Стоимость единицы, руб.

Сумма, руб.

1

Полипропиленовые пробирки емкостью 0,2 мл

40

1,31

52,4

2

Полипропиленовые пробирки емкостью 0,5 мл

250

1,1

275

3

Полипропиленовые пробирки емкостью 1,5 мл

750

0,713

534,75

4

Полипропиленовые пробирки емкостью 2,0 мл

200

0,814

162,8

5

Полипропиленовые пробирки емкостью 15 мл

350

7,7

2695

6

Полипропиленовые пробирки емкостью 50 мл

250

9,8

2450

7

Чашки с крышкой Петри

25

5,38

134,5

8

Наконечники для дозатора 5 мл

50

11,7

585

9

Наконечники для дозатора 10 мл

50

11,23

561,5

10

Наконечники для дозатора 25 мл

35

22,02

770,7

11

Наконечники для дозатора 50 мл

10

25,74

257,4

12

Наконечники для автоматических пипеток 1 мл

1000

1,528

1528

13

Наконечники для автоматических пипеток 0,2 мл

2000

0,38

760

14

Шприцевые насадки для фильтрования 0.22 m

30

48,13

1443,9

15

Кюветы

30

2,85

85,5

16

Шпатель одноразовый

50

1.50

75

17

Петля бактериологическая

100

0.90

90

Итого

12461,45

4.2.5. Амортизационные отчисления (Сам.).

Амортизационные отчисления (Сам.) определяют исходя из стоимости используемого оборудования и приборов, годовых норм амортизации и времени их использования (в месяцах):

          n          

Сам.= ∑Фi∙Наi∙Тi/(100∙12)

         i=1        

Фi- стоимость используемых приборов, руб.;

Наi- годовая норма амортизационных отчислений;

Тi- время работы приборов и оборудования в течение срока выполнения дипломной работы.

Результаты расчетов представлены в таблице 6.

Таблица 6. – Расчет амортизационных отчислений.

Наименование приборов и оборудования

Стоимость, руб.

Время

работы

приборов,

мес.

Доля использования оборудования

На%

Сумма амортизационных отчислений, руб.

1

Центрифуга

291038,59

0,0833

0,7

10

141.4205

2

Настольная микроцентрифуга

30775,37

0,0417

1

15

16.04166

3

Термомиксер

61230

0,0083

0,3

10

1.270523

4

Термоциклер для ПЦР

150940

0,0139

0,2

10

3.496777

5

pH-метр

4270

0,0028

0,7

15

0.104615

6

Горизонтальная камера для электрофореза нуклеиновых кислот

16365

0,0069

0,3

5

0.141148

7

УФ-трансиллюминатор

19570

0,0069

0,2

5

0.112528

8

Воздушный термостат

38409,25

0,0014

0,3

5

0.067216

9

Мешалка

12250

0,1181

0,7

15

12.65884

10

Мешалка

c подогревом

14330

0,1667

0,1

15

2.986014

11

Вакуумный насос

22350

0,0028

0,7

8

0.29204

12

Установки для очистки воды

204199,92

0,64

1

10

1089.066

13

Напольный инкубатор-шейкер

373383,00

0,1667

0,8

5

207.4765

14

Кельвинатор

450000

0,6389

1

5

2197.938

15

Холодильник

12520

0,8333

1

5

43.47048

16

Ламинарный бокс

268540

4

0,3

5

1342.7

17

Автоклав

324193,00

4

0,5

8

4322.573

18

Сверхточные весы

42480,00

0,0625

0,2

10

4.425

19

Вертиктикальная камера для электрофореза белков

37272

0,0278

0,8

5

3.453872

20

Ультразвуковой дезинтегратор

4459276

0,0833

0,5

10

1547.74

21

Хроматограф

2576000

0,0417

0,5

10

447.58

22

Спектрофотометр

166200

0,0083

1

10

11.4955

23

Компьютер

22550

0,0139

1

10

2.612042

Итого

11556.62

2.6. Накладные расходы.

Накладные расходы (Сн) включают затраты на содержание учебно-вспомогательного и административно-управленческого персонала, отопление, освещение, вентиляцию, содержание библиотеки, общежития, ремонт зданий и прочие хозяйственные расходы, принимаются в размере 100% от суммы заработной платы с отчислениями.

Сн = (ЗПЛис.+ЗПЛрук) +(ЗПЛрук) ∙0.30

Сн=. 86160 руб.

Смета затрат на проведение дипломной научно-исследовательской работы представлена в таблице 7.

Таблица 7. - Смета затрат на НИР за 10 месяцев.       

Наименование    статей

затрат

Сумма, руб.

%

Примечание

1

Затраты на сырье,

материалы, реактивы

3619,97

1,45

2

Энергетические затраты

по видам:

1) затраты на

электроэнергию

17391,38

6,99

2) затраты на воду

24077,60

9.67

Итого затраты на энергию

41468,98

16.66

3

Заработная плата

1) исполнителя

30000

12,05

2) руководителя

43200

17,36

Итого ЗПЛ

73200

29,41

4

О.с.н.

12960

5,2

5

Затраты на стеклянные приборы, посуду и пластик.

19922,16

8,0

6

Амортизационные отчисления

11556,62

4,64

7

Накладные расходы

86160

34,62

Итого

248887,73

100

3 Выводы по разделу

Общие затраты на выполнение исследовательской работы составили 248887,73 руб.

Анализируя смету затрат на проведение научно-исследовательской работы, можно сделать следующий вывод: наибольший удельный вес в сумме затрат на проведение научно-исследовательской работы приходится на затраты на накладные расходы (34,62%), заработную плату (29,41%) и энергетические затраты  (16,66 %). Все данные отображены на рисунке 5.

        

Рисунок 5 – Распределение затрат на проведение работы по различным статьям расхода.

Все исследования выполнены в течение 10 месяцев. По результатам проведенных в данном разделе расчётов можно сделать вывод о том, что с экономической точки зрения данная работа относится к дорогостоящим проектам и является очень трудоемкой. Несмотря на это использование E. Coli в качестве системы экспрессии выгоднее, чем культуры клеток млекопитающих или растения. Это связано с большим объемом  информации о данном организме, а также простоте культивирования, что позволяет удешевить стоимость получаемого белка.

Расходы на исследовательскую работу не могут окупиться за короткие сроки, так как разработка технологии получения рекомбинантного человеческого фактора роста нервов и его внедрение в клиническую практику требует дополнительных экспериментальных исследований, начало которым положено в данной работе.

Безопасность жизнедеятельности

Целью данного раздела дипломной работы является разработка мероприятий, направленных на улучшение работы и обеспечение охраны и безопасности труда в биотехнологической лаборатории.

1 Краткая характеристика выполняемой работы.

Дипломная работа посвящена наработке биомассы клеток Escherichia coli BL21(DE3), в хромосому которой встроен ген фактора роста нервов человека под контролем Т7 промотора,  выделению и получению фактора роста нервов человека в чистом виде.

2 Опасные и вредные производственные факторы на основных стадиях выполнения дипломной работы.

Используемый в дипломной работе штамм-продуцент условно-патогенный. Должны выполняться общие требования, предъявляемые к микробиологическому производству. [17]

Тепло-влаговыделения на стадии ферментации незначительны, т. к. наработка биомассы происходит при периодическом процессе культивирования, аппараты работают поочередно, температуры культивирования 20 С, 25 С, 37 С. На данной стадии отсутствует выделение вредных газов и паров, а также образование пыли, однако имеет место выделение в воздух живых клеток бактерий. На стадии дезинтеграции биомассы используется ультразвуковая установка, при работе с ней необходимо соблюдать гигиенические требования при работе с источниками воздушного ультразвука промышленного назначения [5]

3 Перечень наиболее опасных мест на стадиях выполнения дипломной работы.

Работа выполнялась в условиях химической лаборатории и была сопряжена с некоторыми опасностями, которые представлены в таблице 1.

Таблица 1. - Наиболее опасные места на стадиях выполнения дипломной работы.

№ п/п

Наименование стадий производства особой опасности.

Опасные и вредные производственные факторы.

Возможные аварийные ситуации

1

Получение плазмидной ДНК

Бромистый этидий.

Отравление сильнейшим мутагеном.,

Открытое пламя горелки.

Пожар

.

Вредные вещества (кислоты щелочи и пр.).

Утечка вредных веществ. Химические ожоги, термические ожоги, отравление.

Электрический ток

Замыкание электрических цепей

2

Культивирование

Вещества, входящие в состав питательных сред

Раздражающе и аллергическое действие.

Работа с сосудами под давлением.

Ожог водяным паром, утечка питательных сред,  разрыв сосуда.

Живые клетки условно – патогенных бактерий

Раздражающе и аллергическое действие.

Электрический ток

Замыкание электрических цепей, пожар, поражение электрическим током

Движущиеся элементы оборудования,.

Механические травмы

3

Центрифугирование клеток

Контакт с микроорганизмами

Утечка в воздух клеток условно-патогенных микроорганизмов, аллергическое действие

Электрический ток.

Замыкание электрических цепей, пожар, поражение электрическим током.

4

Дезинтеграция клеток

Работа с ультразвуком.

Повышение температуры тела, замедление рефлекторных реакции на внешние раздражения, головную боль, головокружение, быструю утомляемость, расстройство вестибулярного аппарата, развивается невроз и гипотония.

5

Выделение и очистка белка.

Вредные вещества (кислоты щелочи и пр.).

Химические ожоги, поражение слизистых оболочек глаз и верхних дыхательных путей, отравление.

Стеклянная посуда

Порез стеклом

Выполнение дипломной работы сопряжено с пятью стадиями получения рекомбинантного белка. На каждой  стадии исполнитель подвергается воздействию вредных и опасных производственных факторов. Наиболее опасным является воздействие бромистого этидия на организм человека, так как он является сильнейшим мутагеном. Также большую опасность представляет контакт с живыми клетками условно – патогенных микроорганизмов и вредными веществами. В связи с этим следует использовать индивидуальные средства защиты, такие как бахилы, халат, колпак и перчатки. Следует четко разделять чистые и грязные рабочие зоны.

  1.  Основные физико-химические, токсические и пожаровзрывоопасные свойства используемых в работе веществ.

Данные свойства используемых в работе веществ указанны в таблице 2.

Таблица 2.- Свойства обращающихся в производстве веществ.

Наименование вещества

Агрегатное состояние в условиях производства

Физико-химические свойства

Токсические

свойства

Средства

Индивидуальной

защиты

Токсический характер действия на организм, возможные пути поступления

ПДКр.з.

мг/м3;

класс опасности

Кислота соляная – HCl

Жидкость

Растворима в воде

Вызывает раздражение слизистых оболочек носа и глаз. При попадании на кожу вызывает тяжёлые ожоги.

0,5

Класс опасности 2

Защитные очки, резиновые перчатки, фартук и респиратор

Спирт этиловый

Жидкость

Растворим в воде

-

1000

Класс опасности 4

-

Водный аммиак

Жидкость

Содержит 25% газообраз-ного аммиака. Бесцветная жидкость с резким запахом, обладает сильно-щелочными свойствами.

Высокие концентрации вызывают обильное слезоточение, удушье, кашель, головокружение.

20

Класс опасности 2

Защитные очки, спецодежда резиновый фартук, резиновые перчатки, резиновые сапоги

Едкий натр

Твердое вещество

Образует гидраты с водой. При растворении раствор сильно разогревает-ся. Свободно растворим в глицерине и спирте.

Действует на кожу и слизистые оболочки прижигающе, раздражает кожу, вызвает дерматиты. Опасно попадание даже малых количеств в глаза.

0,5 мг/м3

Класс опасности 2

Защитные очки, резиновые перчатки и фартук.

Бромистый этидий

Жидкость

Растворим в воде

Сильнейший мутаген. Даже при попадании минимальных количеств способен вызвать тяжелые последствия

неизвестно,  

Класс опасности 1

Защитные очки, резиновые перчатки и фартук.

Данные таблицы показывают, что проводимая работа связана с веществами 2 и 1 класса опасности, в связи с этим работы нужно проводить аккуратно и только в специальной одежде, контролируя ПДК данных веществ в рабочем помещении.

5 Обеспечение безопасности труда в лаборатории.

Все работающие в лаборатории должны иметь спецодежду, уметь пользоваться СТО. Все новые работники проходят инструктаж и обучение по технике безопасности, приемам и методам работы независимо от стажа и квалификации.

  1.  Вводный инструктаж - ознакомление с основными законодательными документами по ОТ.   В  ходе  него  рассказывается  о  присутствии   вредных   веществ  в лаборатории, правилах внутреннего трудового распорядка, основных положениях «Трудового Кодекса».
  2.  Первичный инструктаж на рабочем месте проводится заведующим лабораторией.
  3.  Повторный инструктаж для закрепления и проверки знаний работающие проводится раз в полгода в объеме инструкции по данному рабочему месту.
  4.  Внеплановый инструктаж проводится при изменении правил по ОТ, если имеет место несчастный случай.
  5.  Специальный   текущий   инструктаж   проводится    при    направлении   рабочего на временную работу.

Перед началом работы был проведен вводный инструктаж по технике безопасности  и производственной санитарии. Был ознакомлен с инструкциями:

  1.  Правила работы в лаборатории.
  2.  Инструкция по обслуживанию аппаратов, работающих под давлением.
  3.  Правила работы в боксе.
  4.  Инструкция по работе с непатогенными и условно-патогенными микроорганизмами.
  5.  Инструкция по работе с щелочами и кислотами.
  6.  Инструкция по работе с ультразвуковой установкой.

Для выполнения дипломной работы были выдана следующие средства индивидуальной защиты: защитная одежда (халат), специальная обувь, резиновые перчатки.

6 Производственная санитария.

6.1 Установление категории лабораторного помещения.

Работа выполнялась в центре «Биоинженерии» РАН в Блоке Белковой Химии.

Помещение, где выполнялась работа, имеет площадь 52, 4м2 и объемом 131 мЗ. Исходя из того, что в помещении работали 3 человека, площадь на одного человека составляет 17, 46 м2, а объем – 32,75 мЗ, что соответствует норме (на одного работающего - не менее чем 4,5 м2 площади и 15 м3 объема помещения) [15].

6.2 Разработка мероприятий по работе с вредными веществами.

На рабочем месте всегда должны находиться средства необходимые для оказания первой помощи.

Все работающие должны знать и выполнять инструкцию по технике безопасности с горючими и вредными веществами

Все работы с выделением вредных паров или газов, с легковоспламеняющимися веществами и горючими жидкостями должны проводиться в вытяжном шкафу с выключенными газовыми горелками и электроприборами. Проводить эти работы при неисправной или выключенной вентиляции запрещается. Работы с концентрированными кислотами и щелочами приводят в защитных очках и перчатках, а при работе с большими количествами дополнительно применяют фартуки и халаты с кислотно- и щелочностойкой пропиткой.

Переливание кислот и щелочей из бутылей в мелкую тару необходимо производить при помощи сифона или разливного стакана. Концентрированные кислоты следует переливать только под тягой.

Разбавление концентрированной серной кислоты и расширение едких щелочей проводят в фарфоровой посуде, так как эти процессы сопровождаются выделением  большого количества тепла. При приготовлении растворов серной кислоты необходимо кислоту приливать в воду маленькими струнками. Растворять щелочь следует путем прибавления к воде небольших кусочков при непрерывном перемешивании. Работы проводятся в вытяжном шкафу. Отработанные кислоты и щелочи следует собирать раздельно в специальную посуду, а после нейтрализации сливать в канализацию или в соответствие с местными условиями в другое специально отведенное для этого место.

Разлитые кислоты или щелочи необходимо засыпать песком, централизовать, затем провести уборку.

Хранение различных химических веществ должно производиться согласно их свойствам и правилам хранения горючих и взрывоопасных веществ. Концентрированные соляную, серную, азотную кислоты хранят в толстостенной стеклянной посуде емкостью не более двух литров, в вытяжном шкафу, на стеклянных или фарфоровых поддонах.

Химические реактивы следует хранить в определенном, предназначенном для каждого вещества месте, в закрытых банках, склянках (в емкостях объемом не более 5 литров) и других сосудах. На каждом сосуде должна быть отметка с полным названием вещества и его подробной характеристикой (концентрация, удельный вес, чистота и т.д.).

Химические реактивы, способные выделять газ, необходимо хранить в толстостенных, достаточно прочных сосудах. При открывании этих сосудов следует соблюдать осторожность и вынимать пробку постепенно. Сильнодействующие реактивы необходимо хранить в вытяжном шкафу, в металлическом поддоне.

6.3 Метеорологические условия.

Работы, производимые в лаборатории, следует отнести к категории 1б (работы, производимые сидя, стоя или связанные с ходьбой и сопровождающиеся некоторым физическим напряжением). Допустимые параметры микроклимата в рабочей зоне производственных помещений указаны в таблице 3 для работ 1б категории [2]

Таблица 3 – Допустимые параметры микроклимата

В холодный период года

В теплый период года

Температура, ˚С

Относительная влажность, %, не более

Скорость движения воздуха,

м/с

Температура, ˚С

Относительная влажность, %, не более

Скорость движения воздуха, м/с

17 – 25

75

0,2, не более

19 – 28

60

0,1 – 0,3

Микроклимат в лаборатории поддерживался с помощью отопления и вентиляции. В лаборатории осуществляется центральное отопление, которое поддерживает температуру 20-23°С и относительную влажность 40-60 %. Следовательно, метеорологические условия в лаборатории соответствуют требованиям санитарных норм.

6.4 Вентиляция.

Обеспечение нормальных метеорологических условий и чистоты воздуха на рабочих местах в значительной степени зависит от правильно организованной системы вентиляции и кондиционирования воздуха. Работа вентиляционных систем должна создавать на постоянных рабочих местах метеорологические условия и чистоту воздушной среды, соответствующие санитарным нормам[19].

Во всех помещениях должна быть предусмотрена естественная вентиляция. Естественное движение воздуха происходит вследствие разности его плотностей вне и внутри помещения, а также под действием разности давления наружного воздуха с наветренной и подветренной стороны здания.

Согласно установленному гигиеническому нормативу предельное содержание клеток в воздухе 5  104 кл/м3. В связи с этим в здании предусмотрена приточно-вытяжная вентиляция. Приточная камера расположена в здании. Вытяжная вентиляция располагается на крыше. В комнате для вспомогательных рабочих на одного человека приходится 21,6 м3. Кратность воздухообмена 1. [7]

В атмосферном воздухе рабочей зоны должен быть организован периодический контроль за содержанием живых клеток на соответствие их установленному гигиеническому нормативу 5  104 кл/м3. Контроль осуществляется районной СЭС не реже одного раза в месяц.

В случае превышения норм ПДК необходимо улучшить вентиляцию помещения, произвести мойку и дезинфекцию поверхности установки и стен помещения.

В лаборатории имеется 1 вытяжной шкаф. Расчет фактической кратности воздухообмена в помещении ведется по формуле: K = L/W, [час-1], где

L – Объем подаваемого вентиляторами воздуха для вентиляции в помещении (L = 860 м3/ч, мощность вентиляционной установки по паспорту вытяжного шкафа);

W – объем помещения в (131 м3).

K = L/W = 860/131 = 6,56 час-1

что соответствует нормам (К = 6) по паспорту вытяжного шкафа. Работа со всеми вредными и летучими веществами в лаборатории ведется в вытяжном шкафу (скорость подсоса в нем 1,5 - 1,6 м/с, возможные отклонения - до 1,2 м/с, что позволяет использовать высоколетучие жидкости и вещества до второго класса опасности) [6].

6.5 Освещение.

Работа, выполняемая в лаборатории, относится к разряду III б, характеристика которого приведена в таблице 5 [8].

Таблица 4– характеристика 

Наименова-ние помещения

Характеристика зрительной зоны работы

Наименьший размер объекта различения с фоном

Контраст объекта различения с фоном

Характеристика фона

Освещённость (при общем освещении), лк

Коэффициент естественного освещения, %

Лаборато-рия биотехнологии

Высокой точности

0,3-0,5

Малый, средний

Средний, тёмный

400

2

Естественное освещение в лаборатории – боковое: через световые проемы в наружных стенах.

Искусственное освещение – общее: все производственные помещения освещаются однотипными светильниками, равномерно располагаемыми над освещаемой поверхностью и снабжённые лампами одинаковой мощности. По функциональному назначению искусственное освещение – рабочее, то есть обязательное во всех помещениях и на освещаемых территориях для обеспечения нормальной работы людей.

В качестве источников света в лаборатории используются люминесцентные лампы для общего освещения, помещённые в пылевлагозащищённые светильники. В вытяжном шкафу предусмотрены два взрывозащищенных (взрывобезопасных) светильника прямого света с лампами накаливания.  

6.6 Шум.

Общий уровень шума не должен превышать 50 дБ.[]10,11]

Вероятные источники шума и вибрации – мешалки ферментеров, насосы и центрифуга. Следует позаботиться о снижении шума и вибрации на стадии разработки механизмов. Защита выбирается с учетом порога слышимости, составляющего 75 дБ с частотой 1 000 Гц. [9]

6.7 Отопление.

В лаборатории установлены радиаторы центрального водяного отопления, обеспечивающие среднюю температуру воздуха в помещении в холодное время года 18 – 20°С, что соответствует нормам (меньше 75% влажности, t = 18 – 21°С). Летом температура воздуха в лаборатории не превышает температуру наружного воздуха более чем на 3°С. Относительная влажность воздуха в помещении лаборатории 60-70 %, что соответствует нормам для легких работ в помещении с незначительным избытком явного тепла [13].

7 Техника безопасности.

В процессе выполнения дипломной работы должны выполняться общие требования технического регламента «О безопасности микробиологических и биотехнологических производств и их продукции».

7.1 Электробезопасность.

В лаборатории используют переменное напряжение 220 В с частотой 50 Гц. По опасности поражения людей электрическим током лаборатория относится к помещениям «с повышенной опасностью поражения людей электрическим током», так как из-за большого количества приборов в помещении лаборатории существует возможность одновременного прикосновения человека к имеющим соединение с землей металлоконструкциям и к металлическим корпусам электрооборудования [16].

Все рубильники, пусковые установки, провода изолированы и заграждены. Защитой от переходного напряжения является зануление. Согласно требованиям ПУЭ для помещений класса В-1б для защиты персонала от поражений электрическим током, все приборы устанавливают в защитном исполнении, осуществляется постоянный контроль за состоянием электрооборудования, пусковых устройств, электропроводов. Сопротивление изоляции должно быть не менее 500 кОм, и проверяться один раз в полгода. Должна быть исключена возможность попадания воды на электроприборы. Ремонт собственными силами неисправного оборудования запрещен, также запрещен ремонт при неисправном защитном заземлении, запрещено включение рубильников и пуск электрооборудования и электроустановок мокрыми руками.

В случае перерыва в подаче тока все электроприборы должны быть отключены. В случае возгорания проводов и электрических приборов необходимо их обесточить и гасить огонь при помощи сухих углекислотных огнетушителей и асбестовых покрывал [4]

7.2 Пожарная профилактика.

Во время дипломной работы были использованы взрывоопасные вещества, свойтва которых приведены в таблице 5.

Таблица 5. - Пожаровзрывоопасные свойства веществ.

Наименование вещества

Температура, °С

Область воспламенения,

% объемн.

вспышки

воспла-менения

самовоспла-менения

нижний предел

верхний предел

Спирт этиловый

13

18

400

16

17,7

Аммиак водный 25%

>750

15

28

Глюкоза

400

Помещение Блока Белковой Химии относится к категории "В". По взрывоопасности помещение относится к классу взрывоопасной зоны В.

Степень огнестойкости лаборатории  II, то есть допустимое число этажей - восемь, лаборатория находится на пятом этаже и расстояние до ближайшего эвакуационного выхода составляет 30 м, что соответствует нормам [18].

Блок Белковой Химии центра «Биоинженерии» оснащен следующими средствами пожаротушения:

    1. Ящиком с песком;

    2. Асбестовым покрывалом;

    3. Огнетушителями:

    а) пенным огнетушителем ОП-4;

    б) углекислотным огнетушителем ОУ-2.

Снаружи здания есть наружный пожарный водопровод с гидрантами, расположенными на расстоянии 150 м друг от друга. Внутри здания имеется внутренний пожарный водопровод с пожарными кранами, расположенными в коридоре на высоте 1,35 м от пола и установленными в шкаф с подписью "ПК". К крану прикреплен пожарный шланг. В коридоре имеется пожарная сигнализация.

8. Выводы по разделу.

При выполнении экспериментальной части неукоснительно соблюдались меры безопасности при работе с химическими реактивами, стеклянной посудой, микроорганизмами и электрическими приборами.

В ходе выполнения работ, связанных с выделением ДНК, применялся бромистый этидий, поэтому эта часть работы проводилась в вытяжном шкафу, с соблюдением требований техники безопасности. Работы с микроорганизмами проводили в ламинарном боксе, соблюдая стерильность. Из средств индивидуальной защиты при выполнении работы использовался халат, шапочка, кожаные тапочки, а при работе с микроорганизмами применялись резиновые перчатки.

Условия труда в лаборатории соответствовали санитарным нормам и правилам. Во время работы над данным разделом были рассмотрены все потенциальные опасности, которые могли возникнуть при выполнении экспериментов и возможности их устранения. А также выполнен расчет расчет фактической кратности воздухообмена для помещения лаборатории и сделан вывод о том, что он соответствует требуемым нормам.


 

А также другие работы, которые могут Вас заинтересовать

13869. Кен Кизи «Полет над гнездом кукушки» 49.5 KB
  Ябуровой Натальи Политология 4 курс Эссе Кен Кизи Полет над гнездом кукушки Книга повествует о психбольнице в которой заправляет бывшая военная медсестра – мисс Гнусен. Военные сестры пытаются устроить военный госпиталь. Они сами немного больные1. Так
13870. Энгельс Ф. Положение рабочего класса в Англии 36 KB
  Энгельс Ф. Положение рабочего класса в Англии До начала промышленного переворота рабочие были людьми почтенными и хорошими отцами семейств вели нравственную жизнь. Дети целый день проводили дома с родителями и воспитывались в повиновении к ним и в страхе божием. Патр
13871. Языковая реальность как архепроявление бытия в «Чжуан-цзы», как форма жизни в философии Людвига Витгенштейна 79.76 KB
  Эссе на тему: Языковая реальность как архепроявление бытия в Чжуанцзы как форма жизни в философии Людвига Витгенштейна Часть 1. Языковая реальность как архепроявление бытия в Чжуанцзы В шестом веке до н. э. два направления китайской философии развились ...
13873. Ролан Барт. Система моды. Империя знака 57.5 KB
  Тема : Ролан Барт. Система моды. Империя знака. Ролан Барт наряду с Клодом ЛевиСтроссом Жаком Лаканом Мишелем Фуко считается одним из крупнейших представителей современного французского структурализма и такая репутация справедлива если только понимать стру
13874. То, что раньше для рыцаря был укрепленный замок, сегодня для рядового гражданина является социальное страхование 26.5 KB
  То что раньше для рыцаря был укрепленный замок сегодня для рядового гражданина является социальное страхование. В наше время социальное страхование – лучшая защита от непредвиденных ситуаций. Страхование – это финансовое обеспечение от возможного ущерба. Экономи
13875. Социология. Соц. статус. « Карьеры, пробитые собственно головой, всегда прочнее и шире карьер, проложенных низкими поклонами или заступничеством важного дядюшки» 25.5 KB
  Социология. Соц. статус. Карьеры пробитые собственно головой всегда прочнее и шире карьер проложенных низкими поклонами или заступничеством важного дядюшки. Человек всегда стоит перед выбором: какой социальный лифт использовать для достижения социального статуса....
13876. Все мы находимся за чертой бедности, только по разные ее стороны 26.5 KB
  Социология. Все мы находимся за чертой бедности только по разные ее стороны. М.Генин. Социальное неравенство – естественное состояние любого цивилизованного общества. Социальное неравенство – условия при которых люди не имеют равного доступа к социальным благам. С...
13877. Соглашения предотвращают конфликты 25.5 KB
  Социология. Соглашения предотвращают конфликты. Для предотвращения конфликтов людям приходится находить способы их решения. Конфликт – спор столкновение сторон изза того что одинаково ценится обеими сторонами. Участники конфликта называются субъектами конфликт...